%PDF-1.4 % 1 0 obj <> endobj 2 0 obj <>stream 2016-06-30T14:53:55+09:00 2016-06-30T14:53:54+09:00 2016-06-30T14:53:55+09:00 uuid:a8755403-cbba-4df4-9a1c-80ed3ca0023c uuid:63dc0360-c43a-4a20-aaad-bdce8765e018 application/pdf Adobe PDF Library 15.0 endstream endobj 3 0 obj <> endobj 5 0 obj <>/Resources<>/ExtGState<>/Properties<>>>/Thumb 12 0 R/TrimBox[0.0 0.0 841.89 595.275]/Type/Page>> endobj 6 0 obj <>stream H\WdI+uK#ခ0Qi#{{rU֨w"o,w?__~|ӟ?޾}Gz||۷`??߸Z~ݯ2_~9 ?y=cgȯ!o嚩y>xe<"* M(&=M!n ۓqD5k~ށG3Sx IUkY8qt/W[ וqQ3%]5uSՉv:ب~\zJ O✮_ ނcsKrBroϲ4pg֯Ah[xgbk/z6x"~֜>ԅp+/?ou_q]MC DٿIO]/xMq–O@ _p }SQ>g!j'd= W Er\2F[6Mȶ|gv`o[ ԗ!t[9Y3Qm]{ &ƒմW=[fO=JG l:Y qߵ&!ߋo]TR< \X<7:v*}&2 Œմ04ܷ{3oRO4ɀ! 8"u4- 8p/ۦ1L.5ha6Ƙ> ϧ+dnkq+HmB._YJ\>Qan=jm\2R\>zX-sB۞8KTgʚVnpg'򎺏wz٢(U6GF鑅^r {. !0\_Su*قnԻP)-Dvh"Z#PZ4"|*Y^Wz $\+<9ua뮈:@yq8X@(c]fݭ3[ (5"USд|9ٴϤFJae|=QLu/8ߏ݄N?tVvEW%YWDdϯ܍HlV&/W"XLyDD؇=]V+*q+{ganew9O1h7(0'S#s䠠ܺ[BvqZ4K,T",⢳*S"l x cI)w}X!I$n-ҾF {7| ]n@|=_0c4db}' !%S:j !KKsHpݭQ &'M3Z3-d/MĮ:YõGe },)ݼj$ZE97%Q8 UG XpEw!2hSnh)S6"1Iػu1)YDL<3V}ҏh0Qon-TrAQEF4Ue&NTuBKɈ7H? @>ᾲldүvb_V!MpǗjq/Di4U%tX" wRVd+*G_ZY\4S:lv kTw`:9 yO29:=⨯n;4:C:Ŋz.;y?I рЍzOi(0 FF~|\LIͩj6eW-i5})V,Tܻzu6%ϮdU7(eɾUӈ TbUQ~jܤ/YޚTA6d #,_19d܊nE.ߏբI<^є>9ϬgM#a5JX87ڬ;|Yʏ7}~yKdX;ll/vxt)5y"CR ]# KoTdx/J a@t4JzGG[@y&J8{X:9,A(p08=nAZ0͓Ni]<] M/dM5`,b47vv HDIu ">A vG$+Z6dS QP10 7~| e17niP~`< -F|3(3r2̡{ug$&"[%Aw(MtÃ]e+Y2n*VH#7sRDNp-r%y/6u@RThS%m$n "IVBr{ls.҆0EY~}Πz1YKg!{o8c J[kɺ| EQ*jAK) JhET;5R w5Ó@ ,7HrK=44S$VkR55!N>DטD8@L4>*>/ 7uzk.zVMN W14[Gb$5bA_GzϱQV HYGmMf'=4ctW9$ OD-q oХ+ %  cjy 6x 7KN85lCDq&Ko; IweCyIxkLZ(M8mzV0y~SkK6Ƶgc,]Uh&%< ONI6;D.Xdѐ>^.eheB1I+d2=i~ G#'P iK|*Cb{ &% 1z팋!,l&pi8R-pp`Ds\,soubBC]_h"% ;9/R#JU܍.1Lub_,Ląd?}F-N.G40Bn-N) uw:9b\XD&y&ƾ_gb]6>O-R:2#LZ?}Uy!zXqKRlu ;u+=qfOd2g>h+Vrv,iNf}haLk1L5('&}2.Ydzv VLזWqa?}z.X_J.M]x^)8%,qݖ:S%GąAJ HQjğdrA\z!YRrl+43b^ŸKTPAТNyVtAxƲEn].Ik-Ib] .y=P_TuT`zw:./,׺+Dz 8 {X&|QnsUbdNnӃ6`)MYH)Ac%;jIf!K@/LCtq֫,wmvN< p%xnsAS^+V6떥? |ouhQ 6ю>[f7ҿ' #=Q>7{xm댯מڵ\Q[>ʑuq zDEH§DWYbvg{ 6w>ktNчMWo8kNzt=`/>xqdZhkiјZ :vM NACp/*(.P);@ ^M8n6WA݅覤N$muE>s]󹇍Zf^28`ȳڽߤ.wjgp$\hih/6k^K !y- wfvTpdedpB:BQ$fn>,ytI!ǫG tҎ4N־g&j)wH%-Y4H`m'\dAe<.:֨l6XP0gzgx0 =uX %1"'` 2Y;m'%WfY?dX*pTt-(6~B}dsrSUCW͌ʥ d5:7lC嶻R8X$ܸ~XR-۩zۣ6xSb_i[؅$O]~9's~sIΙϜ39grx8ps9gӟ9g=s _9s8g~r3ʉ'O)grc8秌s~qⓌτ $D8p_$%Pd,쉆(ck֬j*:8"ݏcK^N?z eP_h\@a: T- A+àMلBUDB$5kpTgՋyr]vᝌo`~ok=w>y҇/{YN0?ϻ_Ӵ,4x,FfS$=,-%weJ *\}lhGYUF"&'x}^:ʮ}+ݪ+mה1="֜UZm4wl-xѾYvͬ76g4<|&oQAiЎmf O4tz=g5$W]0YpNԬfjvg1рϭ/{tלjnc)yqL߻tlA//2Gt%_W? -h3\TzN7񴲻Xà1v&3IqL9P[hbY&T-Ij,AIl@NrRUgsra2nefh{]m-q8 تMMP;\`o^\E%%nZ1r;WܪxۑpCAKx׿(EE_1*֎uPղZٰZ %d^ jQ }yiry ,gr̉O3YwLE[jpkj{uZ2iҰ6)@Ty6hMܐ׊ܦ"hkJ:qb dw:;HWk?ƇQqX-.Uc1M>>: `TvMbS9sGϲ{۱1Ku Z[]ע•z-q%nlvؓ{F4E (Vd9<ބorTvXUeN.lRI>mj3(~]] *hS9LT'otuq yV :#gƁO@v/07DBcn3?Sq9BE= FOZ(PziV}`u1zÍ,| S=4=aeTj)T?ؕ(?AȲM艒X~@5+lC^Lz\& \0nhA`fj(V'!66F5PZȻ5pÎ%9Lv0Ff%yuGͅj 5{BGKDJHrXnʊEV5)puX-vWx}oĒ`ԟ (Ʒ\RMJXE3SEJ%Pq0X+֙1H 4@f ɻsbvH_pQey-ɳucCFM]әilʦC8"Mq%AͲn\`=P5PنJA5qPibqPFԷ TVAӝoxsfќFNTipu6+,g`=rT6a $eeQ̷VGY[@YnSY!)ayKhy, MNЬ~is} >Aa֜Oz v 6}=6Lv 3}i&vl -E0_/G]zO<LkZ(ڈ~ΰhN&u6jq8ǥ!l~e:x]9 :K;M5`ˎewLՋ8Y4t'j^$Jt@K@^cDZD9B"Y&vԋ4aTļI+#P$b-2 ptQj"n[@{5huЭ-e~Z uX/"a0=M8o1^EV0PZDDZ}&YRVk*d~h.Ѳ\Ѩ>[@"M;vp$vA~fc\x;LCqk:qOvc-\Aq/nUB`$)[VT㿟{uDֈpY ;Odq ϫcՖL%š¿ 321WFNe$|v}NR1jіqS4# 0f>wbX@L5蜪|Lx`(*X9]dWSAJ5jjm.׽œܙ>?[K"Ok_Rf?Nc֭kW&U snl4{kVZk"YrD<׻f*/G#Ӻwz {|tFHo$!JE :\m^*`ZtD1Z:Tؘ@H>7bmATUWlU-*i25esph2T5 >]d1D㪩RK!LQ v*."aKC3O r?yhˊ)VtFow';ntPu = G++xbH3nĠW~+BmDliMOt}< 1oAzs8fs7#u4j,16l7gH|אFLpFDC9YndmD7=RQ7] m-;h,V^9E" )R70$[j{|ܞp^cd'v۔J Mnf,\^\[aZn<Rt9S#.I*ajp*y]R\6.݋ZFu=ywNxOͨ}`1=.۷3C m~9ӭnhZ䤐JG{fR݉(d^t5FF˶O!gm=I5%ut⁢r}*pOZTz&^o#d Ao+}lL;’ޠu-,s¬CV F{iקO.w΍3, o.bS2tK5.FwKa'l0J\!y @Y([vX#@HX*wK9bג&;ml)ϯJw{rX֜zuD) h ^,4}tbGE"tzė<8n sd$oSp:(0 ȾDW]B-ƝEvMS6%#[(ު\t"b&m)#Ͳ8]w-ֹT26'`.:dh=5H3x[vU1,VDab:VP[K@#ogG19%lg N_>u 'pCRݸ YobT qF\$]_:@LTaL`_.2L|SIr'zfg6ORC$dqc{xN1D2 c?q-TZݚ~- >ıF8DPlLjt|S9Xf>."{C׾jg'&c;Ia|l!@[wq{4CH_QJI {0AZ!,2^%G1$Z9s}@a:esMT3rxUP/yqR>۰NW`>6>UQ̾,LŲ,[Mw?cLEYQ)y`Gꖧj55fvb0h~^yS0?$ɒ{.e<ږ2۟3Kf&#HF C+Iyą$pRy#0a{{zUS9eY+ )Ko)WΝiz/?>߃>AwkYa@w)uaH0?hgkl7TU0̋.i-;L= meY:-f&"KቱiAm7qVBZTAM;}KjG!Ptjn:vK$v$fM4KaA>27!jXԢ+٢w pj\Wp Z^8¢bIQ~-saLAz X*[5LYcp+Ú ³9ԇyylkM8%ݳ?HϹBsAIP}B$ Ą{yG/ |{&HTݣDihU$n93V$ |F8%sE! 샆J>l(mWe{ұejAk8vM^M&`\۳$)Ԣi!'O[Ah./с4 Q I;U@*p6 1 ѐ3GNGbVSӯ1¿2&y'Io:Ar%ITExBiw& VejJNgzNknؠd.l{ IW6Qm[D Z xBW7X^AY+9xzo\ G3Z )$?_ZXُ…l9 YQE(r8Rb8VS}DD*Jl%ߨ~Zm VCu|0iO̰EI"Զ/9B8tؾF=00ٌ~ݨ|~=yu½r"JpswU^B_i~OlqAEqavnDV!]dY)3Qdct .͂+YQCvUo M9 cé#͋m=-cs^zyp Z%v%]&l~Xn&$/9;ưձ>>ńTK;rH7I[z;R/Eo3[V|c-o}d[f|#7mCnlt/}E~m|2_F룿?qAr[6j·ސ/ވ KpP'U5!ӫjEWc Aإ2c~9Isd}_\.W4^8e, tGٜc/CGo[c Ai @ZWA=R5.;N^}ty9z1FHno/!} jfdxSEUl.R,8yTo{PPfxB{z:.VƑ p"IڟP.# ^d'A|%:Ǽ!7ώF),Y cKUcm!T`j(\ hM3lS؉Pxj)BDӣK7gx1Y8נ` .yqpj0m>O a=ɽޓ~nT?Jf #\ `?΂}cGwyA]J=T/k$Bw&ݬ&<}K͒ 4zmuHE>U%bS-!z.gonʊ* 7 S#|x_GF }5jǕ\/^Б_R!f$@k=\rϽ[^)^9aܤX ΆC'By&7gxhdx9XvD D=y\/IcAxKQj#k~2:)r \ 7p@2yZ78M;MW}3g SXOKtcXQuVHvR|(]a;ae=Alx:T=Z);G6 \c~4p\Ooo&&]۳dse,-Yf9ZRuh˕E ZAf,t!I}.RGmQ*g#d!8Vݯz[z C8mZ$nnNaA܊nN=kJ`e54d&Aя+tm%qU#hopQmy.2$cQ/jWq͍.I")z]Wje5ƈ.C`Ô$r)MCf': /j_V4$0tUs7N1T6ad,8zOwCĮ ]H띍/O~:M+4۹iRFk֔+0`p[ 2v #M7bwbMvuHA_1x3zq!n3蘢H$Vc^ hSaf*ѪR BŲSS@$Wy8a+&G)ҰF*JaoqNXbusRwN A4.{:;,%}@su+ԀIMxAJX!PӠr0$$ў{h/>+cy5" :PcfE7@%69dN(~%u1ʆ)=ŚO.ѠoIjܴM}3ƨ#ꔝtzPڥjY5@YHRW-G=N^CpQ@Aˡ)WvvEVM|)^?3tI?Ag@ěR[#t]Ft`Wi(Fd%Řj_!x"Q#W#Y| { rm(0oxRFxj$7"Zw%v"b~dR- ~9GBͧVgNO#@yaKC;ST\eґnh~& 9wTgan~۱"~lOd=;Z9>h/W:Eu{]D`0|b`u]v{#q;i\Ů(pioYw97b48},SK}o} x5_vQwŁ)ʜ-Ey!Xy}~Njokl>ʜSQg)g:mq֤!R&QN_R5) h[v˳UB1(,ِfha-z %>vٗ%=`XZ:Q;KVaH45[,he@"PaY׵jh[ Tfv@$PsmaN|(N+<[EC[ &pIPTx59b,㭾,\Wf%F 79SߏSus6JDVS>bv2O@<..auβ I|BCUņd'M_u|E+LF-g+Yb?z/nkLԩIpdJو)^?e l'D:*#>Q_mt@EM![JmᙁoC ZH}ͥsW!|C6*ތhͬ&~!UCjw_, uw4U{}]խO,Lר%l af/.h2;*8:74%Ե<{ygΗV~SnYsIȅqёy0K$XMۨ/4 7< 1 ڲ.VMyʒx"D4CX%w,fвsC&4A?b\QR9Z65c(B.lhu-Ge>i$\T,~ݿהi{kiS AQ` 표<~ˠC-nRdʬ Z'ҿ芍~mMQ dgˬS)giҸJ٣1K=2tE۠IMЕ,#򼪪ن(ɥXu烴$J8͂P}j=rV^*ۢO+NYjƝImLThrI5R2;7wEaS "Eɫ)~?fh#BFtLK75V]Q¾&ED0]@*Bt}wٗĬa*naFYnZ2CYڙL񳈌S)N1(_bG=0 qΰ{x;lhWY0 RߔTR3,_-tf2UʼnAہ̬0@V`=*`)c}h+]Hy>Ix\L:PrQ" QV»ګS#lL6vCpDډZHԢ&D煉 ,9m\ٵYLpϫYy1FpXo_j#3З~GЬEp69bmfsM _QBk(2s}rϓrzLDֈQ)Ki_T//KO3儀f5MXF _tPrt/,hۺcWjq>ͤgQRB #./j̻Y6X]jN8GKh5F17.RpGg5 ,T'd In#0>޳+j$%_.r諪2@JMq5<jfC=6kba* IJ]Cigڤb\= }2&Ig.p5u)=6o?"o2Gz}[[y!oun#Xyۍ(3FRQ)9*655rͲњ}o61k}#J~Y (ιEm^41~ i} I;Tc^r1,v|#`\aE͐M$leg$WjX#9T:Jf yn ]x"(#l*֟$B#Gj^.HyoG:DzRGs[&j!`yqF6Au(K%s%Xw5^Hu[č(Wg A2w=i=C3$a؀hCڼR9I,'U =?H5*-uj/ 3!Iړ*)T}b.> 8)f WڙX&碁Qr>Yƺ<d|hyvvB)k=Q;0.p/'&[\m.$&5lfrͻh/+*׌ j}xHŘ-9 ĈfaRl11)IGb9&֯,23K/#v_tMfOי%}P #dZH, :z\PsWך\M+dI͑l;ճUez7Ԣ-c8bZmcE\Kcvgvᐛ6*t=s$#aNd^J n@+[#H. ;f+$Z+9xHC0%Jrc/M 2w7_^_v=R.)G|k7p?3^ԽxWB -tUXLBz'Cޘ;Ξ%V|`x8q:[WRTTK̸BW05)?S!S%GQcZ_N] 梫LS_QPmd(t* o:~@'Ҷvʜ U뛨{u\R^$74ہ8(+xkzVCS!pCQ%O9alko)|=״4[%fmT2+ ?M;٭'PS2V  ᜼n aeR],F!_9v׌k=a0_m ;PU'VmW3Ʈ4qLkML:WYxoqӫ.^%,Ėӑ.ݢK`x {b;/=,P)̢J#nu+ܫ#1ָK8ѾezUq0E;Bpi^wq []J<: }zEz$dV@?}^8-~HvvCWҞ_n֛rji"EI!( MIQqN)RⳄ6Qx6UtbGԍw3بԖcl:I17+Sr|t:7I2f^_CI 1/O?">m&"Mq4,! 0,![W"+EC@UUsTPR[J:0(^<_Ph*xmrzl[ X<ަ:/{ڤV,ʪ7{n3GjbfYL_u""W9?K5 @rjzIstҼ&+LjTd mT~3g~ w3ׯƕ0,[Qqy65pf)x[lf:r<̚l륊55ݺ&l+ݜ}8o#HkHX ;絣*`p 'skRK',Rrfܦuë/L@k.3n~$ηԣ.QL wJDSwʃҳMNi%n?bY(ܪ`C8-=?":'Daw$qpD KF *,Z1$*`uV U?dW9n%Ku ]@ܗ4Cr*/T0h-;" ف6UA)WB_34NӋ7a[+`&8Ap=y(wd\clxz7Vh*>NHKC4\ 9`zE^FT8hMk9hE}{h=IJXA4~gCSΕv1<ZFޘY9uQoe Pm5d Mkdl2J.b S866{5mK\A3& T/ wl ENOouD2'5u 5>OfUށ)YH.uezS諸Ln$\EPrAU䦝]%pcA||mwϹ̹5]cҵ9dd?/xAjtp+t `ň]+V$juH1H`, 4 OOFQWD |WD\l/P}}]|N*ud۟v6[k$Ǧ|Ǐ|d܇d[%a!DNix 6qvCa3HL$.fJ %kbn]߫&0@!uזd #Oh#&Ҷz˩aZ覬~`Y{rBt?P<:͒P:'&F-Rro]-us\5$+AC/.-F28]R8;x3KwԂZClr hv]{5n3оC;qqvM5k)yA_FMM] V]J8Fv/(T䰩 qפ(](ƀsIRӭVy*R.*x 9fH+qf~vu;;wbG/מ'pRm}?0-^Ť !.2\ek d:yΕveXs@dQ 2~Yz>AGBѧVgNOWͳGyaLC=S=\\eڑn~& 9wUgg07?XrtO'w&VWz<ڋ=nQbQY091XT&FwҸQ2[֓.G >wsj ﭯ.8w7qteYbSå0T'"bF$R+T骋u1PNjŊV_Mw+囜)ǩ9{ާR+k1UF`)y\1Z;Dxp FO~yD{ن$Ijv!ԡ*ӂbCTu/ f atr%)RDGyuSp&~I2Ӌ%* K![Rm♂&pC*)i)ΟKG}BB7jcjj"*b085@ f_(޽ɧ笮-p2ӷUԹ q.z [ζfk~Zv/ŠsCTB^/ˣ8+|Fv+Κs(NR.\ÈӀY0jF8%ڷ lexռ၈Nrw՗%p:lV{Y)& U.e1?=72)QJpw+ѳ)CjtYheDk9PxMkjfeſL_HGYQ|2@(!{drS7$J8 }j=rV^*ۢO+NYjƝImLThzI52+9wE߰ ͢CsbLݪugtDMn4p V %U[\MB8J|t,h?]``CC)KXM); Ȕۿm>?U%ɭu@u#/Ȭ} d(4P$9>$-Iv"nX^fis?GѠb{:-O/7_9d#UAj&}iVp bZL.}׸)w"7$,ji;f"5Z)`yv9Smӿ9XG]wHPfx}{adJv?E~bxqhq-a]Mt<8Zں)P{2 g1ޢ-bDH 9^5m9/ 哺#,l,HԈ:4R(LYCeTEw($1ޗ=!?0q#3IrlJ2Xָ~@Ђ9x^N4;Q\xlߔx)]+dyXnھA m22>TWR Sw<%m#ӾbtAz' 0J ):~fψpp5lUHq !Ҳa/ #!d\GoEtEopsvFѲF2]I& pŹķgW.;nsn0x }KoѷMC04Gڐ3mꙝD<hY%ޭnYXm5I2 .L"^ \by&PBq]ꃺܧQWwD_T~SX۲lș}6n P9Ùw"$b1r $K[,_\'#8wVnsh \FR02 T}f+3o4W+wNp.(kA$De+y&1z`jSQry偌Ejiq+m|f%8$$|q+ǘѶm#Ex.Q&1AH7!Tԁ 9Q42uᦣ-8H^$r:A0~?>S rErVUU7+ >.}CN}RC vac4I:ůآnzwM6WF\Ưպ7ԕj?'äBHJ䝝ot8;3+7q_LJW+Y{˳/nL#UIi?8:"PEA u+BPè@&IC;j04gY? $[Im&UfS V%.M6f 2:9&lHs_R%ҡjAIPrzˠZA>?2NNOH*z0ǹ2ft/ UGM STV>;y_žgy&˟k9yTet<ʸ? |O,W i=8UM\qXX2MPɊ͡G;2zfdK њa4ΥbOau |Q2?9 JHQ_-/Ғo+6E;R|;˾Ao[\4YqnyQb_U@;i %n ^Co*7-W=9ERU[A>KW)7goX$䁚" *kۃ~l ><ܴ8OIn(7P^?#Lt\xry֥ؒ>˦CGGv[:TlWJF÷h9Hze!\Y."ϧ#R&nZvx ÚE>l&hiβÈ#ܽܙҹvd~!Һ[Q*][.y a!cR۳" B;{rq0 Vd3xB>h2B77 C4*1ة Aͱň6b"[y7|2恞Bdg& LiKNrŷ"`Y|OX)|P f+MՀc;-4\ݔ鐉jǀB[ƾIEo=_l-չ D"S3Y31 i'e$~\D8 &ڻ\lg*h(.j"hbSDߞhpbZ,^Z3oȷ#u8%أOQr:,B<.Ebm "h= 0BRŻ }\bmdV^zaOg1K5W!: #u4#R|vOx!;C  x <.f M:(vh\€G((d\NCi l޸F`:AR{N[6(V:T3Aq}wiYx♐IVk4 =Gv#ɑ@^1 {!d$gE82?RJ$ziְs]b`urH 0X(%6lءz]P9e2M'\ϳˌd:f|л='駸m6` 4Hg_vN[(^Sd%K7+b eCgS=hf׬Z9۽~>eQLi u7R5S24df;g({?Y2j ;D> ?Q!kn7UVU@dєg[V_,=@k /g"oS&Pm&q䊡:U T7-0l}VK3$eUڬʹ鸙]$Ҍ fFK)Vi Nd»D] +]p([,;@7X֧K֩PP ^Gdo[q,9c"Sw{0BRϕT]Ur*3KUs(-5<)O+Dh`i3 /I4)OmZ glERQGFmOQ\y[ee@‰<=WRi_4M:F&n9)W(eX)o4jy͘~PkfzMZۊt]ۼE!ZIj4fW%+i $ l=1*Pxpc6po$i>+jv>϶)PdwsH#Rfzri54ds.è\b;nQM Sqe"[wc&PWTソJ[,GgG }t<{h2kfr(f4LMaY%o{7(ftL ow>͟Msdk䏯0j%rP/)fq,={B\OԸ/*u!VC#*=Tcdimo=cێK$(U!sQ.N &Nk[{JɈ]A=x5;W;۞v:3 \#6ǃ_!Fj!v*X lج'Ft+0@>?xP:fFQvo;BaX.~~)QnבBFa;koJ@iUsא=r$ҡ`'f3ۏ{ GUzXC))Ե*րfz64YfҰd%flME|,NfUvG,;ճ]ЪJ $jD,E'450jh?\nҫibȷ(ƑUv5BG yjNMAipg l3$j?_=SwA Id%f/w]96A jI[HOK;.;ʙaO<qld #HNLNP3}s}@%R `Ibjm4l2v\Mꥣ1\`~ȭq8-89*Zxtk"MDq dUV#V>Jˋ]fًc%Rw6a [AxC+}Ėu贩Vn?wn-`DM|ȝxy-<-zlŞ :Ew#L[fsƦKgthkU} e9z(FMpkm^r$eWPj \^:]Kc)f/~jt{>E1e4EnPœ?֑smdR([bLޚsR]Fcɯ&Q( ;lDyB: tŃ*`桂J?S[*lB#.RșiB[PDZCms(7:]Dsطy?0'qMm=i%ZIkJE=𾂘b5\FІyTeʺuɮi !#0 %SlC|n_RP ՜*Z -j[5K9Ⱥ"_,C jh\X9#CZBLJGYtK:*U @,ISJ2eǃZT$-pZ,[ hdNn~HY(ͤV rUxV!QTS! 5~ O5C9ݙgmYudQ2ΕXiُhU9 -ٱSOM|\1`yJ>CANv 6, N+L"bma~ kC-f|XU|jl Zfe16Q́,~>]1o{ yhFB 랽n]-BaHG{@˺Wq((xpw0/`73tGᐇ)p#jhu<!lW">m8} L~ؗ.d#czϟjn[pmyߢUTֈ[[GkEmC h|b5 9=SA>Ӫ.z#`> 8']v-ӻF SmR-YD-͡Mlm+VJMtNgk^,&_.f)!Wly*m|ř8l;1Z6f5#Wv{!\TP*j"<-Ąj[N5H5E0vC, $ӯ/d%FL(pO\|kJܳg]wKl+QS:1Aah1X4UAޡ.pZ~CZ42U'Qފa4=Yސah7*80}L}5@Qm0عn !Q4]VjΏk.l^:n6MY |0^)S Oo a N+G ㄲ~jӼ]zRݏ 4焭``*6<*fګ#ӭ{";K ^=QުEFCeDZ,9ukNGCI(5C pDlInNsZ.PiD(=,H襎cčA˦xF+3LʆΧ=1Q[}\\>!,DMjG n_N^,_8;M8Kb~JO=e]F ifx{zl΅W=e uZW1|l\NG7PzB .#6lЭ,N$8NLY~u@ 9R5ۤ*v̗ ]s v6\6cu7g5%ܣvOhٲ(4J_+n]NN ?f˄'ARL9R׬ v:1|Os1k~k󄬔 D9zs[Cl1Aݔu;(Mɼ;^(Z#muӑ{> oJPZ,%{&W^KF3C]o&eWlW("8"[zE`-8U 1L+}IGgAҋl;̨FFꂗV4|P4S aE n$mLS#ZS0f dl`)~%\Djx|q|Sn˸kN{zVRA}8\o34#|"$TCt[ymkxӱU t*-)Vn`l( ;PSpje5/R0sKߘ;&itgq9}}ez|AL73<⧻wtW<.浵q Nj^Hgדi]5Fx{zK_ƐA?}ńVUeZz;3ʂ3B~ɣF鷳U,jYǯ"m'۵J]rPfz6Fu; }nJ\SAj_I5-B@ǣ:û.$6mYSD3.bF_>b&_!3fKL8߻z RUxE,ectVVsۓhT7_*{.F*;5kRGI4x)1֐L:8POf۝vXtF,wZT9vȑ#QtSp[3ЛLp:Iڟڔ5qQ,Z) 䌾~M7tp;AۛP*\y4Z/7W0UMqr(CC/KT~h^%n'.\}|iBkGƧߑ9%Ve"gxbįU-joer8;~vj@t J+'tf&WQZ1a7g;AE=K''Tn̴rѾ.>mTq =5]!u9pTMNMheOc4Ou).mJCXlIJ@7;%}I&nң5k ^ J%*'a&j;ȍp;]܎+5;ϔ3vlх{WDkSztVr1o"/>!"C>w./&%avRbgn.LICN31TS)I'3!!%JHD]Pr -LUIǻ mO׬Gp%`Q:f(4FDf"H ?)t{(٘d>#Vٞ{OMVٶ$C^4bA\Jkh_ʾ9Gn}KƝզlT?Jbt+i$ˤ6c#L(>J]D,s֫o*fQ\:ݾ "06DPoUVBs<^bcw.)lMa# vbkIs;e"k)_I8g*@Z䢧E53Nf-Yqo~oS?l^BxsF֜}B؁JIX#_?yOMKU 43Vt6`GM% rGDFñUD⎻Z6Z䷣c("3`} f(]7v76DLXShX`bEE=HޯqWnWXpKKuvq#XQ6 o~O&!^5U7WX=adz)fפ QTcOi1$z^8KzOU.9zӘ Ҷb\|\(B_ s7AҭkL%<)jzL8fBr)UL7҄mZg>@imEB]lhf%&a{2ci`y㈱;N; "niD ZݭmbgkjZ3ǘ5aG/9sW$@́=GIpH]%}|'D9괣Ӎ# NWa!F@N,^~8!%^9jl$cRS$ZrXm)^ި;{A{V'x,G2I\zX;z,BECn*>+"8g̘!*jpQQ5_T=ӭi E5ѕ_٦OfT (:1Y Ch5fw~uztdc}Ǫq;^2ԣ58k\T&J7@J)p|,h~4 I3 ^e[ 66ͭ)s:NSj+ LWHs\ZċJ[MAӻteϻ4(e9tY3d6djjAMf:ͳB_O_\ epd69wȻ1.$hnL1j6 F +hvCܛ>}M~& dɄ/ ֗΄_?P 5fTj.Iu!|2֑qm+^lx&6䌣cFڼVl7T@2]nfV6ǝX"Qdӕc86s$ɸiQ`J傲IQHOH_c88g)Aϟm0:} IlC$x/&7~tUw5A1q CG\:/GG;&h%-|SX9<OEV/\Bzg/V{=~X$]&Iv0W 8/vn| B6REb!,tIĹTa̖J%- L|H,c f]?\tgh/,!s׳U!^۬aRF99̶Q΂}?٭!Ƀ!뫔+t> 1I()q][0u>܍ˆ~.7O+G@E5{8ar\ %8o. ig}B7O'd^@5g^C˰d$Tg3%Z^ Cb% aTI8ﳚy*):h,nkSi~Z݆Yܰ4s"H?D Q>K#Fhe kgwkY,|& ;^@-(Ms mW5j-VmT릩xx9IWT!9iL>%j-q8DfmΗk&B[Mv{fEAj-Xi0m$zk?7 n?v~ؾجp }rb T)q<-vOjQˠr#ȼ:BpmY#|J5].:I|{:Wm!㑞vBn*w>(m {+yq[~-[уXoXY̤Q`gDFr)͐M)dEQ(?這 ih>xJ6  K4<t2p4Lm6?U"Fهm09^c*;.c.a:˼Zm8` [O!SɊ@5-RTy c$T}aThUӲnɀɽalH7'1텞AbX.-&Y?$wԩ5mtHXDIiC/aE8c4teE 2f-7&7VNotiɟLԩI}Ө4f\N֘6k8NW!ܽ=MLZzyHɱh͢KZ O[_lH{ޒ@USB$U XZ13P+(dSOaH3\ɦ |(\=3iVH/ js42t,.(iɂxV"*"+u YUa5 KfLњT<PK˜]9 \F$Y(d-Ʉd 2w[̈́'3=I2P#Nz\  聦ѭ^ħAaqһX?r( \PtnГvi_:˞!ԂY뉢# UJ~tߵUWσV>+ B[[` r&J ϳ&Z],wQSםM'`4<}@qi.yҀ]q &çE2|.,#"Uw1!ۀa=->Fa#:]7$@/Fv)d#v5!Ðizy/aBå[8`)[H?]D}z ȼh)X &Uv̈́4o5w3kgj8[޲!d"6{/eԍqHsz NpDvZ Je>)*f\;u<LgQUOd86<󝀦P_KA& c\I?7Om7o^Ю[خqaˢJraL,yc h,٫P]i󔛙ޓCK909^WsKèGY;2JI+I@ؚմD|;tu.;s̹{7  &T,t |ѷYfDKx:PljK&hѾޠ+\LlK;VU5ўpTLt&9L8B٪_46=c{E^+9 Lzߴq2N  _f IahItd[fFǟCVZ?tM2܉;i_bHA7nѝZ=Fl&Lԭ mB9foykDڽ*(Z5Lj#H'˗MO]nMػw(["-hX5 *eng{c3Vmu']c˚ad&*A`7OqK[R`iԔ8o^ɞa+jY+,Mn-NFtjSx_2J % $]vJbC0:.5{J&Qd3V0~!u\Gq-%'u2g_[) xHo]'=+^?Hxe#KRS:[Zμ[XDvdP;)^+k(Ql9V#dEĬ4I\rVw2"]UfkZgfӥx66 mҗ`&o2`4 vyZ \&V@;DxT!p&Zd]^rKOg'%03Tm^5r^m {ˎEZt ],h'4=:ψzD35(R~f!Tg:G41#϶HFj&T,[gMz3\I-T)4 f=grҴ״<6o)kf1:|tDv8L#6!Qޢ@Mt*/%?k)stF3$YI;t#ta4@ B>F]qg;G]U 9zKtwւ6vy7lYqW0eV_Vٖlk*8X;87{ؐڔG=ӵn̩rlul5YF̌eaSV>P7vX]^q$@Ow{' B61YǦ>_sԜ+(WI%iAlıD%`)"iOPLPI!$Um&W}FPT!Xi4Onpc?Vb2n~W>k͛ndT#B+Fc7!t q}b-<!Lu}Bҧ/hk&+|`,\.ఁI1{o^lt,.VOLyQ 56 !}B~H떠pS ovF;,of E<~!)xQSD~#l 3K-?ѧ!c,Uā\}"W=ޏ%PQ 0WU$ {xY|_uu9DG嵕 '{\ hy]:*Wg=t4u9jsJOy31("n_G_[13i:CZ+1Vs2lʹN{tOoQ`bPA_eLre(:*HxjO xu *_>~DId4!EإC 9L}|']|?|eY^yU3o4.K;#gTID LF.,I +_RL94*OݝQNg R9֓"8zןJCɪrd]d-5D iT0Wh*Jb&MI(:\R,*h(I+L~_Nrh+*W0Gjp{S"2ױ0ߘ#kN%Wq`ͻX^Ic:bΚmfMRXtn G|ŀDSB (b.El`oNX!lyܿ~:D=%eVje~q^6>SIhh L hm{'QzV5.<+8mvi_vu҅jN(zYj݆LIk@ $WH!ʕn ְt;{ѳ&o'0Ru&ͯ벨$ZXG[5ht†|W?'>Kmffdf3[i8C"YMVB0zJsf=N˹PTܕ-0lfitNwJpɜ$euN}F`d$dZM`eBdO+O Ivt ##+coAb>MTQa%Kx^ʊcD'mz<5`7k]daiϜwr~r!YW*6N~yP&gj8,UY ]7B͈Qѐ*Jɀ5 IDWwG35Cp Ǽ8Xx"$ u+M*" pwh^0qs*_YBB;Ƞy^\Ѻ4uLUr&Վ'Ԗ|ڶ9OFD @u4l=.P>!U,KC,.ҳ,H}V.C'Xea%d`+UlQ\dY7wWn\= Lfئ`36`u`0oqJ SP_.T}K_*=(_#I`3!o0Z2D'ܧASPi]}@zQ@hɠ!DV3 SR _zoaw)!(XߚvC}S'?aŽxܥ.P0PXǿ'-PujmiuD 3^ؗ dG0cfFR^ϜKL80z|yhitqƣ΅^_k55L,TtQ|NՓh& ꅋ4o3reڙpLnpiRNMҽLS{gx]Vص*if*["*1b9*yعLYw&ZfI~NΝ1r_-{?i @] T2wI"˜QMU<{v{“T3NW"M;͉4yVx,pDW]@άw!ۂ9N$Y`{95HlJ)MO]Tuo@ȁU_q~g)HɑyPX #eBƛqŲ޸ENHeO4a Q*iPzPf!5lRg\9(/+{gFqW({@FlOZƲP $#ZIHEsDTfN71D9>*63JO a=ɽޓ~nTSf]/_5>HXHO}#Mo)KczOK0zyF?]c=IA7 O_R2Mg8n`5U%"`ܩ-!z.gonʊ- 7F FP6?xwDŽ\ 8TVpT]d"ӦDb_ :\P\g(դ䏔"]-HLgˠz=}Ի)LH1}>͍x\'5NɐΖL"@\Bs;d8զDpȈ1HF?Ӝ$G܀P%F.H)\;؋^Ix$vqv(T^ޤdNٜnR ?[4Pٳ&3/"[U]g_U86ӷ)V"y5bU-7ÉrhJ*P-1オ`2kSB?BIi~;OJ0=`Jhʂ2FR,BE{1tzao nlsz<*6o}Z?e̥3HoxKe q+hkvW߉yT0hHdWH%3x{Ia!>ϭl"B*65>s*Tϸn|wkN Z);E~LweR],F!_9vόkV7a 0i~ 2Ư%lB̢J#(ގkjF`rqP}:9`w3v@Ņwڪdgq W0t/+U~01y6ZP>7֞ӯ֋qjk"yNȢOnZQ8'bS)YBxM>3ԝ;aTĿFcCT$q5vHXRӱsWHo 4-=(Pt,?"<.WL; e@@}*4Ns]Ip):1po2|S1Z2QSAJPч6&eIw&vzBz[m;K=m&=nGC^g7k*o:ya͛G5]~Sj*IstѼ.!DDz)\IP4T~/W~;ήƕ`Z[(yi~qyv7|#.+kXT.|Oiω؁%v][RMDouRZyh^JMuTnN.RzP_ܷXe3o&e]Qs?u0pskqQ[~t+NKE5~çd_&=-(D= ]f܎8цZb"=xAtU8vub)xP*E)5H"l3vF\s!*ؐgU?#a{Pj4? H?0,5[e0Ӂtz$hdĐF Uf@sHDPA H,9-T’ 傸7!Zj^97;zNrO1JyR/R F>pʆ$'4K@w:aNخx?7@OqgI\899?I#ÛsUhH K3MrDZ`xKQVj#k~N9KAP]bx8 Y<Y,-[v׾mk  ۧVyl& ( Y!A ڠJqtѳNRF?}|9PhYM~. ?Iz|xk$7Aa"%] l'!;<z,+K~v0Q/ݩ%uP\TZ 4j:_n>@n#Ƕ +vZB#]oRaxG][ aXSϚ<)iY{͠;+'Gkc 4]gq]iopQmY.1"cQ/jW1Fd(z]Wie5ƈ&C`Ô$2)M! 3mfڗ!{3=-,9W*02Xg黡Į 8ͻw*;ߴ>f<6^Mە2uG^{]+l0`p[ 2v #M7bwaЈtL祷pJc^J[Q=w{ TԓȔ*{#\ҰF*MvV}pBԬ$]w&C0(]NJ|`]8cOh(vRwR\uqK}Rn $:WB dтeU= V/ZdQ?Vkl}B?n)Jcw^cH͗f1r P-d CYkbd(pns,\%3}+W͙bG7aLq)~yNZ JDdO}RS-.Gߞ=. R#*-}CE NnB5vޮM|kWӯk[cLy1«$.yu|8JUKdI&0MbDV[BXzqV:~==y5rua/H`׬ $^j݅ ث@Kq U=uҕ"=|\{9l[>r3𙊁gsbfӡÕǍJupD߉2J(!g#<~4! &>j8FGECΣ}?.҆iB\y-`I{#ftt?oy}{%dNyzXG]2tCVK ێg9Q!|X :QiȎ P)->s͓ʉABGM;tIɬ)MW .&4.s5o3}euq<궁RM>hobVJb'&r-L!9$,5L$RDEPMڊ*=5kOua'xmPa?" ǐGZSal/$"5rsٽ;F}y$.*,[W]h>K뽼s2}Zv·vmC^]J2I' u 2~Yv>?gBЗFVg(GDy|auLpڋyZ!#!ULʝ@sSc=8b'oגNd{K1юld5xnIL}9.C&FwGҼQҜ*m[֟S/vncjn$[級n?G_SD)^ݗ=h@]畕UggŮ~K]xGF^A_:\C:2gljRMX/\Euij˪,vZy6MXÖm\{٦^rWaz U>Ҁc`.zS{D0 UM Ez]l迏hhy uk6Y6 TGd[Y]bjcg|jkX丿.iÄ M:^M(%eb|W݄+Pb|3qnFS+{1o~ }rf0%A6pӗE"7{8vMV QV4r`[}CD0u*!_My}Jw&Ұ8f61p&~I:Kuxł 8j4}[RpBA@kw<\V?+74YuahPK=7Tt7/D` wty5TB^Y}Rݟ:׻Y'ev_aHu| _O]~s쨴ǹ))!78Ko2Vq+ 0L֛-"& C.fEg(%b0 ](/$p@n6< 1I 𮺲.V-LZx"DBX7,&G@ù۪!`\-ߨb7ޜ1)LeVX$Z\`juZ+t2[/k_,d~>F>SOԸXLDVd=rs}f7fXFV+:'ҿa7A1n3ڦ ǺZBR]Z4ϱ9ԡV&ӗIÉmP &iJ8y^kA ,Xk$ǃr "Ip!q#sV^h*۪O*N ۘNa-}Ւ.k$ddg5g%~ޕMKCHî35 6/ɻ~{ zo^< ]߻&;8 ͖i8Aetk4w8*5Zn@rrh$+SFZ 9! @^ֱ aYQ4J%<&v:9eDC( %H,:T5g YE8Z[i0lب^ٚ}#j'%Z t5e4֦AcԽL#cp$0cEhWAn"MTH[->tp0?#@XzDo|Qg!CoH("iI2 G6Z ,?ɚf}Нa难8:55c0 FBbL3_8m1ӹ5V d,YGQHPqX " 'l1٤-#!qS;ҫ LWM4%~wd,Y\n0@DrafC zjC!Ь`s %a-PS,aCVԺ `99B>«rޚLjuLOsݚmu'FNT+!R5V,$_(="/qQ7*[ۦo%ȇ9tOn ͡8?ii" .MAUԵbz627z.In u _`$o#|{#5r }jLHxe}d.-# fm_q(wDw'F&ft+(}ԧ~|!ٿ)Xp׮Ccuj4뇺WwwFQaJT@!P[Gc$eVÔ]tY-¡x|9fk7vro)vp’|jT(YRs16Q<͑,†Er&]Gy5e` R :!y7wWHp(c|t) 2bZ},R1 %ya-`Ó3D3/.EW^eB`Gi>DJi8/2SKvkKzW/Ӻ晐ۧқ~fÜ)coH~P(U]=F oN {CEfРL*Iȋe : k J.6Ƚ[Wx*w5RxC&9 x'L; XcwZC_d%=~ qEV3ѓWj,j.pRݘ\ŋxjVH"CgjhF42ޱ]>c?[y]z¢oɼTX037,M1 fR%/%,-%7Vظ[]VY1WIA<٥)7Sp̐BBn)%|ϟ]lJ466$B.Dl3$Y)"/PGLLrPasDȧEi*d)zeQK^*ASngͲ,L¤+|g_+u4񩶙)~m<;/H-s5 y9? su <\Va;x('.fƦ_`xC˱P)mw&HHʮpQ◍?jdj !+ƒyVFf4"n4C΅"мmokjD!3*ϚweH^{.5  -蚝"rsly̚4ɺ*-??ewf OghzU47 vT|vZ2TP:OFCcWZYb,A"i+m58" "a|Lih3|ɬÙҙ)ߡzSkvO K? l  趼#K"2}B&9{i>R^ˏƩ }{] /.S Gd_>x?2YGU0X3*飼)Zƒ_޹`[{Ow,9Şd8ﷳ̒][%oO]<@){r5> å-V-6խZ$3QB3}jvՅּjzfT#J}V1g~~S[>0 |⁵jDSxyυPзmf>b2WkIezLbN9~ -[팩z9]` I( a*]!E$m1|aΌk \`L6~ƽ =mh0;Jy, ;D[H\߮]}"F!;mO2='e_f6LA)a[+g`k@UB:>q!<[n{>:6)0P#oUby 6O%+/޸0SK䘂Xy@hjY4fN2nJ'^콪܏ԧ5ϯa-Pm -EC0?t]i|\#eQ[%Kpo̭a(mOgCGKIw*U]Ё9 )|M+3eYwe,;ŦUZTL ޲A+t*/vrPtUh D߬S?wo(I=žm-A R"i,y±g-wsړd'T0Wө oB(V1YKU-2a](TVB6Þ>,ʀ4;TZ@zqoq_L+wE=v#±F6Nt-=hvQh4 hNM.jb"Gށ"ReN#YhJ-o3 أCMKJn#I:~H7Y1D  ?C:Ժef/],sOԤ{ 41n`-Uk<` SSBjTwUo7mmr,6/QYҟ؅7"5-%p٩Z*h͑d#cowΔL7}DӋZfCePQú*/-uHB_ k#2JwoN>꒱wdltfG*0ݖnٲΓa uˢnn ٖRq)xMǽ`CԦJps gN;ku$ŬCHe6ϪNÛfvXz=^q$r.C"o41ltYƦ SsNSSW)%ieĵD'`(hKГJƙPE-SǜlH\O=b:*=>9~dvGGԮ^<VQSHD/#}S SI1c>:> >!Ӧ"}mXO'd37rx1ՔKDi"3k09GFG4zlQ 1 Z#?&g%kCX4#jQP\P#/x@ַ UH!E(:#NDt717~r{$m|g;pd}sh̸V`Dڊ"iբD#Ho qxVoߧ0u=[l|umA͍, (#}Œ链]׍g%Wl;Nc_uҍhbMRrQ ΀.I":UB#ʇ B)rfeo/5ޔ%ʂf2PLn䷦KMI;cImii~6~oJvIlCWdn鰙UAA$`"h^Ky|Y/捬K57=l?4/_VNNPPgvM RX]F. ,YA%? .y*UD,J]&̖tڎJ,nsd@.€QKhyĆj'PpAo05Y̳M-_ՌBJx7y^):C}uAN+/hW?J2@k~df&msFFvz2JT@Y bv#0 dQ`Xٽ)TKjP!hkrre+U;e*de##r/ĴlnT6?E^\-fw$ +I{BX=8Oz3!tמL`/ڗ*n¨/LNj=9&YR-iA#m@` hE.vT$֖s)MWg k>g{[1 \8=V@@G6u~<Il=Ó~ lڏhג*KOM mdz5¬(@gQs`#/(/\_9\KGZ* M1q@,/2Tz'ֽe-C$dc ORd8?4=E;7ڽH*%c{R?.Ԉ-u m&YMo mjt?K-F6Z7c)EDEJ H79K‘k`k,3:-^ta!k 0`Lu>lXE)1뙛ytĠxKE.SR3l:^"2{v)Z"\8`,z(uL)+l].t4rPykP^@ >IARr6^KgD.==U맓> aH0*IՁwUQYᴸIYp`5nlE[7ؑY8*_z|.եdKWyи9%pcs",{g[_J5`䜋h:ID*onRu`dC☎Y>;:tYmGv,5ɚ&$UݓgVEu֭lS2G. 8߶F\11nʔ髮s\T]UEJ+Nlڔ1Vy\vq.RA6F:iwцL}]=9k1W1:WF4gYWJ4r6>^r14 eXosDB#,+o/!38--2)7u׾D睷OPe0H*^#I8!f_M nI4_?4 9ZVexpSo;ƎDVc[!U&*Ӥ @Qٕ)LAM=ƚ_GS5Y-- tU8 $ۧܐMŧ-noRMEb##nuX,j|>6:'3r~Z Y~0@~sVƾge!?+ %>f2HO译E#bQDlM0T1s@l*sneÑ\ ${neR߈;t8) ;B6]_Xvz,| Z—mS9y..FL|!7gp,5:S"ʬj1DY~wJr41ckc]"`1M7^#:ك/u*\=ay3V`JJF,9"E UW,%qd}]Y Z|,&fc|GKc: O=ԁQl^vK_(^ [Nl":cN*\^/)Cxߒa7sSo 9R-= p&Jr$q=_ȁ=uJBEF# Qb:6R\6eR6BltuD@@*JYXxaMFst`h{kxO],G?GlЍyQg,Z0`:$,Pk!7p)jVm5&i(!VּU&!q!:ķ%u3bjA Yz+ ,VP+Z5VQ\uA[Wze&^[ B: Tc5 0@Q+OnI~ˈi:7.H['04cB)a [9i{8zfL%I4㓄9$O?mLId8F?CKj:?t}\g鷳B-פ;+-P<Ի{fU.>ڃsj{J|`#Z* a.Af&T,,(4EbRRdW2^rMMSWlDMyYŊh5YT:q& njׄ-$\14"#S 53M:z82[_RSG+يeY6krn*`E@njC\j[lR)seAh NdX0O9:8t$-x*,;@8[%+TZ(x#w]-8l2J<Ddxy!(+,U N=D!Xf1jmg'i%,UrU!V&ɐ&;%x|_KO&2[BԠf,QۓehE?WޖYmeh1?Pp"fU'iƕHM([{h.J,!a#V Z`M_vک%d+(A"e<2d՘k=GkX*XO%e5h;!<ܘ%rǰ6=쫝8jc >`ԃlBZ ;Y0rj[` DdL#g]z?ӺgH=_%wt)֜&ɨYqjm!(ܺS31懪Y%]g:B=ef>i3)eK-77eFT\ۻqgC5cj^cY?+tMI__(z5wS˒gJBH5c z=F\b6T1ơg鏽MlDjۏel;6/T=A;xrqpn0qڞR\SrWNFZh߉FԶs(nI6 IɵYn=b{]1GXϣvԲq&ՕNz}1_~GJ#Dw#R5+b6l?Tcli?܏ug(uU#̋( vo;3}K;[$/qH!V4*gHÊ . n?nKؚXJ~[4nS%Ag`UG t'0YN hJ`~ 8m>[n̒Qbo3'Pt#/u5"^U rHb|V3PWY""vN]0T'j!ߕ^v%_SK@2~:D4kvʳ]vN3ÞvM5b"@/3ge?r^5`m=bQ8 jTp.&#5n|DCrI6zGoy7#WcETl@"jέ3S ,P*{YrX^,5;u^z5)ydH-gRz+ 鱍]ij\#V ϬGMŹjGjz"-A|QD@u:r'޷u=SݼB PݵbJ V G)cRnښKUB꺢BoI8K2F2v%Uc%{:,_lszTfOn*s |0 vAID cq1vAF* A 쬹%եk4fjɍZ1F^qodyܐ`J]<n3֦+#.Qȁi>("-( |Ev j.oy`NY&K%{]dǵE% 6MJp+` 1E0=4ȍ Өb7euwJ7b]$1Bb7=,XƖ|M9}ܑݧa#Nݢ4)?j^:e<_UcoKAǽݚZ^I/r9e u />šCW__H4}FE|;өJY GmW\ 8#kߍO>|7>gL{o2Ctvr^K8~ #.ǿVDš0Zv5yK͂88c]t拻=̀ˎkպ5\R!*g=$E MۤK\oOr[߲H]Y|ܿ2'2k0Prշ "q:sQ^BzT-wH9BmK ”*jR%{R >]EY*]&YƋBo0w|%m$3zhqkb{YK.kW#A(#9귮0d{E먶g%ýz;Eɻ6oVƨ<)>h{ vu>&2W۞Pc,X\='t} F/WzV&QS 5~;vg-_4)ތN\OubG+sG *}Ȭ/͗WӝQ ;'9u09*UᛰTOHmnxJx6Z|:]ɭ zq+mPgFC:tVһ+#\~+h8~W7{4Mn|>|D)\scE[㥞hy+YpaݲםkE',S]hYj5̒eno&(v;nh8 ^Ӷl#0^@~8ֿOzϏG+ޮtԏ&kWI_\[#ll1&B](Sꀹ:O u1`jXrr?\'T抈NyAkzf u'ˉӂ=% ׆ W"mCAk"+.ʟc2eg`(6{\VBK Ive(< Kfj%5O6\/ 7,F?ayo}|`ܧ7քIQ#caBYAin?5i.=GWsVͮK. &1fҫ#ӭе⸪{9K V=ѱޫEJCeDZ~#m7ucN熕FP} 0ۓZ❬yW}71 RDG1a9B3u3n V6C7BiW6|w>H!uڪnj[fѬAa vivk%8)ʩKb~}2.p#4QO3=>m6Bo2KU jM^uNG7PzB #6le~;tk4 S5d'_NDvBs4ou6$?kPS{& `ƍ=@~Mj#EI2<S5J, ׊GSC_t2kA,~Ph9R׬ v:1L/sqkk,D9zs[l@ߔu;(Mɼ;NZ#muˑ{> oJPТw>KI2גPE[IYs*4_S-_|"MYG]>>$zpš1ieݐBCjdD.xiJp} eɮN:0eVHѽn gO4z1e@>r5r5/8U5\T o /|CsmwaysOD9:~0,m$!b$;h[+\\iLAv+gC =QSw>BY2έ<@/R0sk;fig9}}mx(J{exuSp4i\~w~mQ@S#?,{A'HDR-M`b[ ҩJ}>xx , |zr=M3@  osc<%C3ZUr-9H X 9B<+~;{|N~}rSj76u*x[[vq<ǹ^sݞBmnPZrXz9c?MDOjn3dl $+%=8Ŭu]}m.VyX5ZR],fBIjcMˍ p&r1,efXvt)Om|XوM'22lh{#7NXX^+$}| 2D 4-󨥸P{qYp#`͎^Э3%ȋm˞r{(f?8 *Um|ædk%\v Ot>~qv]e*\۰EB8|*̊ bwm$77 5 \6 5dž2;m0y*Nq'7)3;F=Xri BxʖB'>Ģ6_w)6ꩡ.I2dkvm?&mXU%y˸=;ʁbC˫+$*w{ZjɲM\ ')tcZBbg4Fi:$x;_)BBt4/;J:5_t=XXHe47Z;:Rhms)Pҭnw/[~ccï2Y3-Gjk ;̾'bb!m\'g4ecxюbְgWg'hD\F~ f;F,uv_ UJʍrTߎ eZ# _jNjFɝ;x,c/ azgAνO .o OM \S?CjjOCQɈtx$/"Z/i^SXCΪl݂pmѿ3ۜQKp*rvQ N4p, ]^TEwhcY&:z͵ 1Hy'7 bJlc{5QɄDbc$c4f,d f90m$.e:c|oiOQ mO>l1lnBfVJ U /|1rrrGLۤF%*C݋f'zX{(R],sL[>MI-c]ȧ  *NwgmxZd۸MN`_=%;ظ̡Я"Z^Rk fX룈c{4"LZeC|luK\ܒ/0YaNnRk{M֛h.S?O?/ []u_^F ꄪA项P&"suգa`1$:#e-al6 p[U4'HaYXph<Sf![v7_,j)^"zRߪR{qΫ`"s.iF~zU8 Qc3Az 7Uӯ^apfTfc QUsjVi2:c%o(;'׀zE]17 M< ݖU˪Qҿ=%Wrmߞ)|8Yv$Oʼn{X:Wm( .ᓍ2i'ҁ̓>Y >η[ZE3Dr)g`UuӸ 9ӃآăV$9hV<;)P!;}]j@Ǜk=-e5He{9I;Vwvnܛs'dk lz^$5MLI2L5aCmӼa^>.\MdkGř?ƵhqLn{^0Q wՠ*À5P^@&-7N Bll4sw&'zpn؃$p(t.I3ypAdSpliTUm13 |OiSEjgo:3>stream 8;Z\7bDjC^&?TEBTE=<;%ec2pHpU$D!uLi0\o>1+_6gO&k%h4PXCNkn`>]sFHd)'h KR!Q>Hj&m/4C\K+dLk0[o,oE.K4EnIqXkNfIHhPdlC%.t.rTA"(>\ )i7_A@^m^&`o/@(-.-0[-)R/3Zt`JcX(Yr.cIeJLX!AtEN+MNFaTG;_hQs3fH+Xos _13,8\9;\Y+`'Cma`3"WV+J!]3^nS*6q\(&B8C`]`H?r%9'""$_;+l3-0j^Xp_6+\ 8%ejMnaJ^$RNs4D%d4n]*o?gSmI&OVC/X9Ynico4PjT73N,\3nQ,e4#@73>8NhHfG f;mQJ,/2*+D0)5nkicR>)ih[=rZjpWGAWN(/8Xec+iL&c~> endstream endobj 13 0 obj [/Indexed/DeviceRGB 255 14 0 R] endobj 14 0 obj <>stream 8;X]O>EqN@%''O_@%e@?J;%+8(9e>X=MR6S?i^YgA3=].HDXF.R$lIL@"pJ+EP(%0 b]6ajmNZn*!='OQZeQ^Y*,=]?C.B+\Ulg9dhD*"iC[;*=3`oP1[!S^)?1)IZ4dup` E1r!/,*0[*9.aFIR2&b-C#soRZ7Dl%MLY\.?d>Mn 6%Q2oYfNRF$$+ON<+]RUJmC0InDZ4OTs0S!saG>GGKUlQ*Q?45:CI&4J'_2j$XKrcYp0n+Xl_nU*O( l[$6Nn+Z_Nq0]s7hs]`XX1nZ8&94a\~> endstream endobj 11 0 obj <> endobj 10 0 obj <> endobj 8 0 obj [/ICCBased 15 0 R] endobj 9 0 obj [/ICCBased 16 0 R] endobj 16 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$>stream HwPS -Ћ!H $!.HZHǂ DAJQDқ4A =3μ;͛y;7g5u HL쌌]\t`-8`nn :\ ñQG܉n@% r KQd yy(D7/2Af)ԛ2 dQNr:@27T.YG3Dd,@/tWG`ϟ pݑfz9eS+q*8 /?& 1r8jF=(HpE$=n2pjb ^]oMq G-?~:A엂D?0^0*MNQyPp?22W* Pjs5Z4m133u1)ccMcepiL\€*r]p337t4l6|-G,,ZS=MTWߛȔN6O MKkHؾq w"3FjVYvg\.4O0_䭀۷>İԵ,zÇ3!UOIE}ϳ MfրK/s+_ut~yMFp;^>l{A!vT#8jBh1?=1?;12_wt ̱2Kڅu⛰ŭov"v])@s0R%BBM4)t~0)FE.R#,86.'\a܎3.\(O)/?'"%hJ A*YG$FEFO:/ux1Ᏺw '.[$%&'>MN8{Mefޜ\<|[ GPߕg_tR21Uդ'IOKj:j꥟=~8 oh%|վ!ة:B;|m_xCQHcqiSgftgX>_] Z2[^L6~nUbqf6݁xk  LAQ(л;1ɆYyH35VO6U8+|#Ӊ ~Sg/̿)q4$C Qߎ'JHKJKde+19X\#P^IA\G^iWyIeLOs' ]tub#NcfZ+ 3V֟N ~85`o08zzi/.[{P"ܓKK ȁ)M!}a,(h^bgT_x{q)DaoBT4'WFAKfZވ̺\p]{닧JKe**?sPD-˟ugmFME-}mKtݫ؎΁n7o= { /@? J ؏z~$Os9=}s&w6w|B䥸s+~_\l׍on"ߖvwǿM_ U D 2-&6Øa YNL(%#,Vk 3*G g >70^_><@QkbJ$, w\uD65eI(H2HKJee;J\ / УX줢 W]TkS/?nyB@K׬] =I1!$?P9+F'М$埈s aN_bg8SaKbmk`/lvp:&ғIFGh HCH'8+y ;89E,{P8[R^4V< Kxl qQW2:HG r;A;bjJ ߹/3?z(HjU4r6\ttL(ӧ!è^+!d Eeo_87}/tg}KLsurc.p eӎ`qt 3,#|Zh80I5]^K= ǜ;yyC1TxA6G6zW[h ><1]^~|h hO#PT >$P@%hیoK/{W4yw8 f8e D*RBy;`nQtVy:_@ϨgaJ.?c}z5M7D>XP j2{89 O #/a^#.y?FPgq?:K1b4wߘUuF]WqP&:=9ݵ`ez}1mޒpd7lY1-uCrjz19"z/ 2 caZnpHu| zP1iDhTL.YeP]G&G,,` ]` Aѡ-/s">BUuF.{T}ؗ) N!"GB;dl߅[LpـnF9 ZXcL8xէeW[o@ē1VL-#C&k*K&vV,*p$i;Rxټ_PG?+\ʽMbL6))r>=@x5*fv]^Zduz]X?P41p 9Q~*^ *,0#%8b;Q'p*$LEf"޵wǕSC戽Hah :-"dk>uy7C/)d%x`'qyo SY "&]#6؂5;4uWy tk/ G &0,#Bv"R9 59oQm@;/D5RIP+-GM#º'uhAt0";=kմ?{-We_]ډ[jA )H>Au%W#Ժ>D.ٜJA1~ S̕V asUB 䪪/j)+68˼=wpmbnv\ߝtGOx;`uKJ ̄wAߕx~Ϟl.ɂQ!h0RȥjEGlsܦ5# J58/G V//"N1J;mh`$?,Wq$L$0lJVzq+ĬЈAaix!dpTP/H_ zZYs-dqN U)$Yǭ, H -Ϻg,7xeIHh6 <{*M@+{ Pw/fID. O-Me̙mu+M­y!@*D> Ox0LA % v[Flrt@q+ /4r X8Dm*Q/ZB\@a8~r;E=,7!oM2D[..Reړ7tA};GbsWh q2A];%mi"+g=Uf*l3xݲ?I a~ /&.u 궥 >'ggUi AN?oO%),z~U޶ 3^Gj)ȀZMۂFiPnQY#TVtgSVD^O˿:JOg+SMnveKlou"̋'gøSzّ[ oIpkк½+/eM=Pm4?EAO =Ф>˭=@tVw {[u)jW>'jcJ|e57R1a7/zu c\V˞ Bb-C~}5ְGU*Z$SmƩૌL "CƼ+g~>dwE͢B`Ѥ*]vQ)TTڒWЬ~E0!U~Jqb `,<7q |?ķz\w5)r-C#n[-V 1/ceSˤpm^/hOC0eծXd#GQ(HJ3`7޼yofq-Eߦ~_ڎOZKW>(C8(8>=%šЦx>ǝ/@'3EHeʹb#ӓ"=ݯQMcOu䅂A~d+ʡ^yk2͈pRtzdswB8u9]7}CꫲQ] )>^6&$Gk{«C\L`ȣnggw ;.ˊr_/C:x)P]aΥ:媀B3-⊗cpcـ=#ӗ=Z"#j%"b7KJːйcle/_>‡*E7@+V6ŸnvQGM]wTnG<2 !_,>P蓧VwN5[,*tgGvR20B'džɫ+ tGj x1jMTn"AKFoUkoȱ*h$e1%#*54N nRΝ7ⶂĎ V"8%{4G(ȫ*d+~?ɟt#gG9w[wߺ4ݑĈvOrb4鴶ר=yR:p(bHY-Ƞ$D~)5a:GXmr ]c^vzKS8=UĊ3c7o1UNϹu!8EGpҮ69 Esu|?Wx5ɻ3FI a ~۸ߕ TCY bY#thG:tW5-BG^pw+.xZ t#4r uI_o$郅t/*-]V:SI#< BqEd_07Ɉp0 e,%(IkLgu=Xin## Ί9W"o;!t%-Izx`to[!֦Z?Q,YjwgW tCOTmW}9Ӓ B$pqL?5LRDH|]gpOhz셠kJ$ۨ sOk|8C "rզqc (:/k~%Dj[ihH5nߛ-787_A%V"RjxwڶᎣͿ3"汬6EVÄA'X*{G~GZVAZv}&(lݽ6$>Yԟn-ZT3(( D;峰&pۜ :J2gkSIJ}']V WC;KX_="ŸXʰ #ލ=Omp(e{K  nK 溞b@mfl_#va^Xw4"f0aAҰUҷ`,."4*kĔQ~$pwf k33vRIܞ =|߬oS-KmaRf@8(M_!^3<.ẂXש?{غΏ{h*0I 8G.6hy MBYnW"v vhZn?lL,6XS(i)IfړH|E8Mۀ])>ZɿݳzK=IǴAK)jT|~/|x7L |{R.YXv /hiqM:=cMYCgHZrqqeNfFz.R&)φ,+.Obp.5^W۸&P4^?7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+- <{$*6aWm: ;^h(zUfb 3`7)GH$I܊賏[:.mjrupTFgʛQ_:= e4V}C?1]@8l^|Eb?,Υkz, 00X m[<?bPAߩ,C] IGe_ ߠ .1^IxO/'`c R.1B8- 梛x*g;ԗ~KtCP^W.T Dw2EkH|0`W*q"]|P&XbĀC\1=.kCլĊIUl(ha^ȊKJmXpq}P9Vaâo^Q#ŜdD@@φPފ YAɈ~joJ V@ZK.9@Ya΃d˷glĝsg5Ņh7\ |[X̑BAa#7qb̔+z *&3(Vcҗ.' &1O%D'M DzFHq K0;J5 7GdQX"/! C\8"wv%>+>r'ф1N[Mƿɢuo✔b/HRl+W|[{ṕ)LvŝiC؋pׯ—g߬ +1+KL!Ԙ@|m#>`V(S<{;PXVK~JxY'VV}b{7anWT4[ ҿ\݈lbR%oNCl:^sZEѯZQ-33*HqB6Jwhgڛ:gդ73s=?Wѐ*vn):AНy=liC4X Qע.273ghgq4WZܜtm|>x xRr!P s{P"_PŠyW;f3x^CSW) ((\< 25;} y$RrF|_*@uN$-'?hp 08^`lw`Yll`ײ/lp q28u{lbۇ̝9M;]w[c]|B[v4hL̫%B"HPgp"?es1c\cekE B7)*ѧ7{>ĭGulk(67aRܶcS|}<()2L/ΤX.`sk$Z<%S0aF~l7'y i^2N@HS&xpyRF}Nք5Qd-!c%٘$cL# Zx..m}1K橤ybI֜%sSBqrMї8mr0)YͳRܹB wWX8Je3)}U[ )WO{eTS pJJyςG5ꪲ5\E2zP$\ YFtQwd^Nk+J*6VDy[JB~3{?=cƌifhEJcpn|\VtP rfW,ծB;?Cq9eXc8ß+͋ǚSO붅R.s+ƀ}tຎͰ՝W7۔Av+dol6\9)<:`Z2^M{ר8vWA1it}+4~iD?Q)pC63:>lm~8Q=ӌ*`{3~|wT7Q@AX-Re1CYTL/&Na%づ!o<.ΆD@hLX!V[0|rrɳ$ `M[q>/C 1wEtHt8Eu%UTTl^*!%U,kF܂0!wi %"I(s\׿knu6F rH( &U1?OP|vINI"(* b خ0'kMԸRO3 KyشvYV:^tFƔ.{od%;V:6C&1nG(y%^eOacD=4ONi6썂; ˭L`f7Qk{2f7PI"ăW(^\ $b1S.%.F6;oAAj[ T>f+(n_I߉^ʻǫbȌ[nq 13ߏBb7C Ӂ|S綵<*/У%ڋDrܱo|RהulsUZ_fת@^uP6T)#:ςlama$Hl^z'1`XPҺ}*%]ibd9&e@՗}@v^HdnKn( ̖{]1;R ;e#ZT"?hpiK Bzޒf1zlRIP<΅R1bm],2;%E7THM>+aOέbw?R HGQK+6f[ev&ŧj|xR4X%kZ% Nhr  HzOޢ[WJk2V\^Jpsκ[GFH'3Yb}O. =דgM!.grWsG @d+Mw8|oA8a 6'GCg5ɇE-h-;^)(pdϔPY u_Te.#!S*0zo#,,~vï:9wՔsU CKWWP)PbE8ʊ w_{zr_ YY{X~ */? 9e!+s<>&.F6һL1jX:U*$ION{y/Yf?ֳb fRowgJ[9T ܹ,$~Z͠I3!MZ)%rKi&yNl!쟢#" ы? p{1(n?%#T3Bym#la ߼oÌW$e-meҡrlwũ ߏ`n9q#l#O#&&ELI *&/x }vuL7 Z ڡ>k$G-)1="Y_w: j˱LiYm! ;ʀ}bZFr'^;hͰYնg0hE6AL%eO%wAݞa?UBW24a:Qc᪜~yʦ/ dWm_Z!ÿlq* MlX[͔+l;):|UKeo3W # )ln>fĆ3 _yL3̀yVii߇k4[p+Z~ɮNW WB~l^Q%¸k=LzbBw -lƯ* BD+R7[T*Pu2Gn.(+QO^K#6`.m@6?e÷ Yk7|RO;1KKCXo }Ic?bVx*r7k23{7}M ;=3˚P1YldHv^Jg1͘܇L>Lۡ=mz!b= ,;1) ,%=3|~XEq1o[9^iUSlwzXRkTNP'JeR@݌1p4@ٕK\Ƽ42i|S`D7n.\|"Pm4QX!:# 9Qqb.'$g/jj)?cNF=R%ȟ5TC"/A%Ԡ̟uVmvMI@V#Gxt%CG:T5ɻ5?I'Lwn|ͱ |!\d-CWnd l[ ujoT^6ݖDJ(?X`yt+`˃c8Be^bUvRs-ga>ru{?VK3(r[ܓ|%_#|F|=Iާi m߈0l108 1"+9L(h_UK4wFw#ˏqyZ)vԨ "kSͲE~fy,pN<<6 eݽXYۻm-; ujp]ɥcRd94M8HjhpMq:)ޞ=3U޶ 5Oq}Ri'!.gEWOL::Le˾FMq.3J\%|G/)^yS 7%Tw#UUCs0}* ڇ(jWA,ӘTR r`]Crz5_VYA9?uayK$mZiin%44Q5Zq%!'Jj$;tр a,ߛp,=Dշ{nk>Rg,*CcL57iRXZ#EoP ?ҶC_=~vǹ{*N6uW2'{R_irUR(5kx;$d#D^vS:2r[i<WΩ텇wƬw.n4]hlt9/ъx‘;vjjG)Df{׵'8yGWm~MSE"70]˝4Oڑ5|j/@@t'("2h8@$$j$pX]md%WO, 1{O?mShʌ#e3# ($NxX{OZlߢ@Ñ"G\t!nTӺ1~Z%I9zBu-r]f@&\Y˥%RMN:g@W2ݚ $cMSBԶ(~glqIeY8 LԠ?2o$?9a s}DZ4qlse -X"Lk-?pr2i@$~Ó2Mʉii}ppʬdsƝX3K?P20l,$i|d%|_^pc˧jWSKS>񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{}6xBxvPŬ gcn 7N\VYgM`TfM~o1*:hgKxD:ppqR /Gx-5-Ӡ`_ol ts&+s0K2'AkO* 7UdAjD-Q&!Q B \ 3h(;l 0weX{!i)5$uۙ.mD&WdXQ6l44+\e8\SaOƞ*˞!}S|ILJ\ h8񜴸x$<~PZ?wJQԔ5 FvS:r]P"6(F^]Se >:1*ٛ>LUh\W-[VLIkIHl t0,x Ԝwe\q$**&6(w$׮|~<NDYo@cuh"hA(w3$ϛvY?qz;*܁ˋ ͔o\/׸, %)gaNh{N*/P0v(= 0?ER.ocqE-輏'l$m'X <۝|!b_7sD]&1b+r'"ؔ\ާ7-rܕbMxswq >"5OE"ϞGG2/#w5m_QwRrRq<$W`K(ABc>%%D 0oD`D :P˝nYE5e۹+F2Wͪy"9u/pQF$'ߕ>r3&=70N@9 mUQ)!..U[_ ?KFJ4GĹÄY$ܐ''\]fG63IAv_mfax"C%k4BbT4TՂ"k<\{dq s7/d4V {lhxZ]b[~=ifig 5Fb(ק9;O٧ViGGX_}n]wӸik6f:,p,@бkbmuFR!s37:!?`CW֧&`':gUDtx4DLؠ²CKh#NLoosR mRҦUa9B6c.oo18g JVnv[[mFGvzB+J02Nhļɍr/ 䜲Cy5(raDlGx~H?I.ȩ GH;A!A0sARxJ8*ۛD[Ѯ~b W.Q{!n(1_9W'IlCw'Cp^~u% ^pV& > Mфy6_E%.xA01݇"QC͈ZK+gD2sϑKtOt z nf9 ?Md$n|c-G\zx 1~F;ĚBtB":E&'>"3$vAPrfm#t&pJN866n^yOOMZ,z~ Py$;l*|\7󱇭 ؒvߪUDl?ᐺ,"uy )mܞhqS:wdREZk4cS>nW=kvKPmGYpfo&]*YV.#^LCxTrz )s=\||V+w]mԇZc&r~2fAcS_ he)>t*qQt`1x w֏+I۾:hYK *9I|8Yk^nT| uڿkVܥCA$r*S$s,ౝ+z`;mP걢dbP% @]6 UUu nIR:^ar]J& :þҝm)%қFҚp} 2e d';(MdFڶk ]*HДPPCjߙ m> wE2j샽/;Έ?* ,oqS6wniZMfOdI&~Ej*tcHV=֗7<Lk2XF]E=m,6rU蹲P/WSEFlPyzS8Q:/~`~kLS 0RߪnFS+d@wQlf6Vkd`j⻪5)0T5 8+F9yᲹl( ܺ),,&L@!A~VSHIe"3o%4*%yV "_;Sa8iqk¦&m&*F^XbBϓ.$%_d nC^36^$LI|yIB 3Uu ê+z;EQ^}NW%'%3mD35+۞AFI#7'_1m 1˚wEkG eZaV7Uͅf5‚"m/)euw"FYwI׵Xq [8f2n88EOfQk:sXpcuʒ@}5u ?TUf݅]m[-S]Лc<"_.×z;,^Aɝwp36 i‡WRj|pI%(E:"L{+:eȾgdOژ9ؔgF:fՓ ԙdb:JJ[pdR"QfQPgeGE}bOSZ p0Jd9 ܽIrpGm]$h$0Åzm㍝|Si aYvq%ҞY[iS= z D>x̢L# dsV6S'ɷb]T%/y%7[]X%iLjj#]W=f&0]h=0yx\P ؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ gXSТ(LRp*৥U !!$$wߛ{C I0B{M ED[T~{QfiŌ=~\C¤P/P%`vָ)Y /Y4T?5hMsqjq+:m'E)̐/kby@}{DR39놑>cvvSDžƖM t?65)`o&Z]d?qF4۳}lA(h|}]f;+ʹ @갋.+'n&oA\!R\;u"Q<7!ia2Sp>&ΠڴA2NPKGU;PomBp: oBv:khC8|Zp@_+nPy_@iiyi1&o)y -wSuP$-_gK?fBX/zQ է+v [+Џ3(-]tY!(y e辬9h ro/r%shxu/cP}O:kՏ@9`Ys3Crz 'Xk޸?i1GF)eDK;hز_6AЧ;rl%ۙ:$QFVwp04sf8) w|1-R͓ykx ELуCSL]*R)p̜:Rیh_<.9]QqAJKAmao:Bv/20%!;9)L͓ka{&(}{9lI:RV*҅VG܁`@*a/&]-ad{K͔5-O oۄs kgNO^˟J5YQhl:/=y%qNXD2D^Z@:3sz0ow=+,b{/. R0q 3NyG.:d*K%4U=أ9Wu"gb{3Umg5 g}xFO]RqޗŲfv5gW]eWC;SpFbHy flO0: W띀q\~#?RҤwPw@TzښY0ldӮ㣖e: s/:!g1!w<<>`Eսºshsj-AgAZB#J>ݍmȨtwXTa))A? wGPXkm _BIѨ+ ڣ㞠t7tj}7Deߣo]3%j%Hn- E/GXr#3,+b=?^'NC%}Uss6p)n2|0%wiC^0mo#703:|ܞ+¤ sW TmJocz}a Ҽ؈ WǖSKl$t_@*CTV z7vdr]&4DiOQi lp;#K}&B׉/4"a$+08Mh~TRiu+a2&dg}y j`D/%@3J`<[rO@ojƛiCA F-y\H4tj Ys~T:eK3 xJкDg&vhh\ 6+5DľGѺHs͉}dU3 ͫV>2  ]-jxP$#LmNܫyZ44CDcXj66DgmZHSd}Wlɾ[oy@nę&)Ι;-~(.xrZG`znr YoB)`cТzٶmixC,WSeH)5ڗ>B>dS#YZ퐉FyQ R!,-j"~jo**e; I`h]<nVD¤Hb,q(Ȕ4ZcGP=sQpv/R0!pxe_l&!?F%GNw33䊘""=XC7Βq/߉)˗M9h;F奢.qY8$I-BD/ĵ#L(>f+oZˎL;T O'{XzE|H>PcU)'ItJ&}>wͧ3dQ%{z ;-'L5CXj>^!#ͪIWhMsfZC&9 3WʏeL)!acE2'(h*A)?+f7GHtcfի-(U+bІ]Qx[Beb; \h3J0 DMM;Q[9Ԙ8L*fd@kR9rLDg5ٍBuJCa&NOlٯAM :m!vİ̞;('y *1\_M UH1("D H٠hdC fܛABf"S"Y EQ˧ҴFTɍ Ϧmߔq;K/G(:'ܷb^# jQtkA}R*SY<~522]t%/pN+t֬ Nh*{]YqxJ<+KKG/4x1%vJ1aKtׄ\&I0GIW)O1)}+% rD"Pc@?CNM_^(6ڔLAʯȿo>-}r7"w:()2I1_vZ4^u)j'6kV6V, Vb# ?/;̱;o5g:nĬ7},4mG6_n) yҰ_2l(󊞎hs`L]x7z.թQһޜ첱nEͣc:6ԥ4ݨ`j(a֍4kɪRM]Լe+-[Zb_Hq6Zن:2+}Ec]ZH&:LQОkdèi_V.36$o^ϰQ-E4<7*,+}3a$}r RHjgKV\zRffmÉl@$]{%qf,h`=Zo:5snX5~ ą(J||5v hGa};WO{p S*8"7xD"U+7euIR wejwtpO1Yt37z h3HjYh+0`ҕ#ݶb?&ZQ~ )TKty ɘ1r)G^T>Q0ON\PP+8\6zQ-*Ze^Pxe dP&ub~JY!Y/!]1h>@jVuF'lqV螩m1:UH≢8QEvWb\#ˡyNſ'\u/H$wuψ MxoI&v}!&yh嫎\0txcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒl 8ԉp"GV_lRȑ!R1>f13fc3B}]ښX߯6ax4Ḫձ쵺9U[sKmyS GP mWlDk#XLꎇ }qK/cH+Mg53Y;+' 2rcz(NwV@87S߾kRn4M5> 6d\t"gE7scLìyCQte;Cop1\mFM9ky+@$z FJ(lSʐߑ44l1/W1cVģz&yOqu]&ЉO(aKv\qX!0͡#,WٖM r]S~³Km#jc=Bf3>"d',EodbU})XO%yڪ!J@U~e ѼvӋ@qnM!{ n3۲c iwuCcS:dZ7;Kw%7@ks5N'A̝ra{;N93&`qhJۭSיά׺#420$j9CJ9gVK0+H`&~=s* Da%ZCC B l#n#Wϑ+Kd0y WĠFy怙V\0FjLMa o ".3y;XJēj3?$&LmB[Bzth1Cӑ|MƸkXm4LP3Gq!pbM-ܾtw$!2fFz$(b_n-zz1脝[Xdaz=YnQyKU?؎Z'c+U܋]ʅ3QC~"tN~R184֭5Bک+HR.MJ0Q ,; =PmhbaOZG|mXs̩^4 >?@Uzڽ'a8,Y oۃ<)P [i H60?[^&=NBG 'i]a# @LA5&i6u3QsN=g6P`f+]i@'RG@=`eU~Qa!:ǶWK_5PK)P>-hΎ7Tհ\W9'i6["%ӡvȘY) IN0aI !5t9#$1$g]0d 8.{t7MO "nmaa1%T*CJPyj^^ln+T,@ :b̴S6,Ik0JA\,H!̭\R(`H:.pqIx5ͯkR|=m;WRq|)Yf+1~M"%gz6[*eF_gN>OEm{Qy%yI)/O"mr#yBAԐJ#ӖQz9Gz!dA[~2di"nw^XO(Y /"%gbJ'GXmlz@EIDz^9sޯ9̫166j?ǫ֢e,]wrUX>>%{|K@); 4jw@QOZO'8ey`2:<@}]bQ_fy֓hе>"!R Ycݚn0R}˶5\?fU$ 0FuR(` y>| \c]m4ӫ {RiB:okd"*> ~QuIP.|u7 d%T_bB=ֻI<~E=cn~ѣ#ߪ'l͞5u S[ 7\pBEbQL^:l +RV&yrQ՟2G4&sNwԶ3+Ji}/jZx,"d{~yGRX;w)G="q{,xں?U>)!崸tU3Dz.#>8DÁεǰ`G  5T<8 5tvnk0'#O<2PwndO(aY2~ ,⫈o0"fwqrMnHDKC BP.U%XdBfЁ0):}`8M{ğE[KHC沱K_Õ0A#^Z}G>lK0zAK؁7{"LA[ CA# -nrf,lp%ǜ(l0yL@-yDS~-~e S4c^z ]5Y&p^G6 tk ΋@ qѶN6I`a?bꢗ `Pl{i0>#xz)FXہvgڮPxKkn Y^㫳3\~qUv*mI{RXj;,&9N\FD Dwx#YvZ򚹠NۙW)+(YCv:+4CYM,ٸrNF"I~y?)LZiI|`N]{ɿ;fHw2IİeL{Kx`*Q }7c}*72`Sٔ# (%,FS>?cu0 !.VvjnEe6f_^uUM~j~@∋j&}TX/jkB_yzn/a2=ȁ#v u({X/CߘGs ;9!猬/~u읪O8YeIqKLoRQӴfKK.ADcgT4X}nzQ+i=˸BXK}6T {e) rtv}I o.-p`-\񪰸YxM78WmM' :{*p^ʆ8_׾@u+dIWЧ-CRy:((f{3/ X']5ex%] ~%^ At "X]-ig48|GҴ 3" _pd=DSFEK T)[d/JsI.].K.,T *VWgŭu<9>GIy1iAH"M Pq n_}^1E:c:hڶ~*}kK2g%d_o: ~_/l9PKo:~Ty(mmaWHЫͳ/stMDxI,LQ5 SMzt)$"`rSh K qr#D O[5}yH4&{zEk&Rkd)Y%V2@q3(9w1>h?h FFf &R#`T>e 7kv1ЊȬZ5mMӣЙC^(Vϗ~Z՞Iͼi:XjXG|(=EY6{T 5aȭ@<_P56{>HZV)r}{)owYWc\i#m5Zݑ4ӉUau XQU<]-}!e \NfQ,u,.|O|f~\Z? έA }sy%*_I)ο`ߞ6_ҷ;I\la Ch)Ha{~ T' 3zIgKw{5czֺUw: bĀvX~fծrCi ˳?qLr(|# /[cW}BwsZk>KcYpڸ?fr+"4'90Q&OVt\q]s_x>[2Tލ (Z_kN4 LEF)"bv׸ۊ<.|ԲBT?X  hLcԀ ci.W$-lBB5 +_ƭ$SYo^,^rhT (ʥ )4gɒ?s"z`Gyو=\ϣ_RHO Oq|<  6J rU>{E10Ipe6V DOy!  ldRp*<s-qwTGJ*_Y$,';b,^vO'χjtZJԡ' c;l?o7t=-~Ԯui87uԕX.W涐h'y` Syn?wdT [{/\߻یל,yĐBs S-\r77dho߁Ua[ancOIw]}Yf#Z  ZBLmDCᖧnnGrν79 Ep/dtu]9 _]l .}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJ <ԉ]*DmW-9:E"%f}` rXJVwmzm,j[Q^KٍHG(َE4kXׁgJ./ w$턔@OxP y9VlxZk|][$HC?nW3^#4#`'-q%;Q/خf̛`ƭrw O'erϩutKeJ4@x!@/I_!; y@8,Z=lKzQ{T/!G=Jl-x A 3F6rpJǚ;jhi-+ 4OyUVX=oRNwPFV<m1*GP<,yyfC%T/QyM&_Y88$ 8Rt8 l/E@Cૺx+6]0Bl)q kd "Ym?7hk$"P!(0 ,V ohJH}nJޣDY"?ޔU=a-\Zq`8g9f\ Y|7j) [ݤ^UtsNo׬!(rZ7C5y'gϫA;?JݎBņȐzc*K?]3'7(;\ޮ4*|KNsB!+| pF`OWp"+&ނhĤ=- {/5&2=(yA+=?9SJ} t*DlBU(ѵv"9s>y1zȭV!eQ6_T~7FD]Cw[k>D3 |LEH-'P8YOz2j = ^ u)>QJ$$~=Q Dp7!aa΄E?Z6n;u95~VT^>) x\q})Q*flfwD,*'}=?BuppQF~)GOFWW/h4^֪͡kUj\uEʌmd_? ʞouQ) E) Rp!%~^݀mlD+sbW4M I"Tq`h孁;2-"1̄G ?XxAs~=pQN5F T-Qjau!MPNi.? B+SO a_BL~nhw%G~y]wJB`E} oe7c[_j$'(߇ |6lTB򴽉6AX+aO.-P5醲=DMHPo5r1O+qkխfIRzjY).A[6FW|{./]Lm lcŻې/13p9紸9.Ï4F>Kع[Gi9—5XkhvY_݃ͩfs?% ixy@v '}̓7ŴG>yC_A^9zM4̠ug(.'z Oӡ }LՔFFO3^3iIfW ENֆ\$,K*䙊,rBV.ܠeXyIiw[8Z'Uqhc%(>5$ܑj2\gvi,8ɂԂ;^ q8 N(7O`AlYʿ3WGvRF wy&]=B)+D_7:zrzC%?*!SfS[x?j(S:PKѭt*tV{>9}ޣMJh 5ڙ" )dfe$)eǵ5ߜJ \iC &)֬ Gb^QQCBe@|%xD2,Z*첄ɳMI}{Hϳ^k :%(ʩ$?'펠dIW;Fs/K->#n\J5d["tY`L-UӮx["!.vψoKh++쭼 'VxhU]'V'7 |IJl!ԍ. ~;pcn kT!8+G6|| {H+ƌ+h(4f[  Gg`W': h?|&b(~Rݘ!|_nCRעGL$ EJqtʽL:#sZD,QREIpY͊ŴX.ϰ),vUO_Q ǁ, &˵ +0kěY 0/J}+^,"8xd@1;t$6c-IC S~1L %d57SE;g65N|v#e!!YH/(~*!)h#j |xT"JJӆ)0nGya OY9^`%*$'LTgw@!!a=>>j>mPbػnX!mSY%#C!ﵼ='4Ut|KaO+aWc%^^[^=3lXqv[^dVo{P fܮ=2spӏ7Bl{B :ط3&N_=@ 9ˑlW>` =Fx8*>zL[`㛻ͱ%(U;hn頑̯ϛ'@5[\#/N^>-a#J-P mW ͲXY}^%=<\7yE0jw\XzZU͈޻g7{BmTtnj U5'_%_hI*OWVωsCU%oT_`-Id$,$5~u>UVjKDj2*u}? MTC.aB.3j:@c~h$:䧒.u^H^*GAf5\џ] U-Lpt]TцPcY@V%/S%1z$f!h)ȥ,g$:b,6Ь5ex]>9R 'I*krG]ȴP$菜)LZ͈|s-hxVQWtTӧ'1uܭ}[3,n YYшXfU| qȌ5sg;\_Q=oqEI:GW-qU& _` "x{8pfj["PE֗9Ӗ-۔7ރڐ肇nMvz`'pCQe D[;PCKE.x9Uu,ڄx|njozycp,%eregZiOel&DnX7ɑpY*r1fs u{Dy|io=ikdzC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H, aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aR ֬:ڕPrXU6_Q8Z}^XpjCNd1dD @Hx*55{he5~,tUs;GyQF.9[YTʼn$fW`60|Di]FJ폌t;g\Ot*hx]/G$m#iZS;ڊ{s7K.>rv:܋¿zv ց h/1!y[D2j䛋 ~P4W?_Ia%lM wO ]mk~絬*Q5K_9]]V0c3KxVHK-/DP>H\/$iv",w ڬ(v ܳ76Ye4T" c.Ɂ\ 3[5]|ޢA fL2`=t"C_P(2NW>K$ Iy(¼=鏰5#Eli+qe#3^d]$ h7F2:c/۸# KBOq vJb;\VI; :O̤Ӥ`_ Atp5X ]}=E-c&%k ~(N[঱) 4⧆x W@F6ȩٰuf#O~ W+ y_#Tw#B>(fbK%,rИ5yS02xbymbE##@ 4>-4zڅhx{]8)9lۜ{dX+$PV?V¸eexoz2u4y/o;I;,QjUO#?w1>5>S{)4\s(nfY' \[gv*!Ag6f˾NsN|r0q4Jby@Y}LN2M2G2+K7W <$?ъ0Gy+)~Ia/G<(z@K8;HҽYLIM )aQD*W3[Q'g4fp;&]It:\/&S1NbXsɣBߓ#A_3qnKnBp4E¦WعK%8\8{BOy$X1K!Cܦb b9!]?z_h8O.ȣmzL{8i H jE^ %g{2ekUsjOW W,X\5h[83] &ӧ~j"GmmnWi{^U_`LfF_~!q%>ߘu  "A6pGK1?noAV7nb֭J2wlk11`O'(S7JiO.v07U筂L,biHb ?D307!iX 4{/#R& soUAaW ^M;ēȋhmSNH>5VzgK'6J~.O]PCKCDkU-e' TM3U$o;* -(oAnUqpsz?n 46ڝD%.C kXP$,P~ I)ldIN?Apc\\1k?6JCѩҩ9i)Ih_M͒'ږ6syuV*s_WaOUcJlt*! GcP,Iyi&Rae@(v\ RxBڕW/!GU,OdرAaV\ǨT0n|z E:G-X23nEOBQ`EH2ߊ8bc:t-= 0X(x6Ctca$CvnqOIl lO) DZ]%nbJx\>^O ~Z lV+Bܡ|߫8z~ܵ\_jՎxVGR?>4ցa?xN }g wFue>E'qʮvl"h(6xDQJ8PUd /T$; E1TIYA:H9>`'rd'G #0k6H,AE7e %a1% J"u|L8>b>_a~is[|3J e_*$6Rv{ݎ |.'8= Ѹ)Î̥x{*\9RkD.25t{ʍoum xX%+0_NjEG7Ům}*V`JÖ2,fMsқE_g'ڷnejiRP GZ)E[Lёh_i"jeڿgm-&rG?j-< CNIUq-*lβEmS P""ϛMήӈhG#Gx\{"IaԤg@ry  #]3Ý HSGrDDD7]85/bEF"]PuI*2,[VAGBx͖;h/TZ><a(XdLg,hC~DW[޽j}2埶holpQITVE)\`MBU ^r"9vux: ɋ4W.Q26EpOhb۝{UȢ68dC]X=_v5oXk)aYAvKU`/IS9}Z=U4=h(݁{s07dZkNhm"}&\I&˭ !} v0V|bO&8>A 9Ѵ71iK]"]_@3W"CV}(s@pJvJc>a54.QS2ǜ(1#ZoZe]dWP_ֿIe^R-L!VgFz'j+~f]@fgy$#hw̦<{=IնS 9޷Ȯr>.~i-14%Q,{9&mP5&SS-\t94! l HˎrBSfӋV#aSL@Wb.{Qi\B;ыudqw0qecje* #3LMV* D4UA@e#CH `2_򒼑e(T-XQz=Qi-ZkUruz[-Bv )-|-=]󨌖d?PM;+{(h ؓw8+x*ր!4Eǣ(ܨgè (1[ZBU/Bwߥ/ h[t]<\,S ;H%JS ' aRWIzBr2ɑSads|b%P&Rdރ |NX9,DaB㬒;܆rKaH(_/DˆlYDzEFs<?;%-:m+ Kk)~xsnRB<Ÿry`^ye!d$_.\ B>ق)p]4\RYNYenvV>2H5;qз=S$@ Ju"0@Gs j/fXfV!옫*մ /€,+ ]?TsdQ8i9CЦ1xWvWuZLOoeb0;\ hrC.LJM_OՌ5 NY@8oQ9Y7g:m]Řc pcMcu\Oi h)%L۩Z<ËBMg˚pͣ1ZFx~|I=[BOIOPԧUAq6ڼEyio"Ebg7h04FnQ1b<IT?8=DCUr7? sv2BԬ%F`w s0/Bw\CM0A& HԆ[p70NEӜ[" [2,2xKȈv@]uCE޷TzȓtST8{C2O%.x{)w95@j 6Pc@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK WS`e)ꩈ X, (C-(8B {so !܈ WxĞj}V=u=p|?~JuՄ9ҊMnUMI)8eռ`y~~hcԏ.6vI6#e6W|]Agp-U&SMh[LӮ vuUnE![sK]iR:tP+gp6U~U/~(Cg=yhжsP"%/V%5}◄*q0Rœw0g3ƆoLD>>C|F^ 6oO WW.!$Ր OԯjSD-o!Z\))2ege.˟ 8PB$Ũh$v!  fQojvlK|7%܃(.CDZaM\)>-́˧!ct (Z1n{sBsj*!-QU2!w\h?||s:#^.#LE)!56Fy.[%O:"m].^(-#9UdiҰxiGMF*]As nks!Yv-XsN8MU-ɉF-@k*uOէdB٬3VxeuP<4/۸X'ߘ&@\ٵm'FUpW?<]U4fˏ"VYղAkJ)n K{vʯl1krȴDnʚS}n8)re]Նl*-QOdW*b@8~(M;H?e>amаcHlBy>ӡ/ʰ%iK:B/ߒI };p"[՟z.Mfہ1vX˅\^0S}oe4FVZ~gZxe FaL ˮWܯMZ?Z[Xj~ـß++V!+*8X3 syxhYSYhO>yi*6D `R}䪪p3=]rM>\ ^9#&ăOennfj)Ĩ4_Gg._'HBhwj7zЉ5T>)̵;*lSTmVlؚw Ԟ64%O5:N '7Mu^.V~yG޵wBuh`4K%?#I>/%O f c~՟%xoGP*/91KOGcjGc噉X0oNE >X Jb'(%7^Rg#=X T@NKdAב!i0j-;2nLtO/o]eJl~?'{W x<}G:Eo-<e;Ѽ$Ϳ2H% W!'E~R'~cK2Lf nZlB''x j3i%y15Dȷ"@ 'c8~<F DWxwŇ0C\Tkq ̸ lbLst'FL<$&ec爗I՘=r_c>Cl)1^шnjK/׶PqB?]#-XkFϫ[ЃjϨ9Ruf";!8(ae E;˲Н]BSȨє(C HP iw1#BmÌxhp;_dRJ I߰!_cΒ#Ղ*MWw[q#`~]\zii&Nw-;e-=aufKP;j WXuXs/zjՉ‹\57&Sj̵4 h3VRf(.wJgܺ5-\S ‚zt.1m͝_n|WX0R:rV4&DYovA^iTm &I5&`0dd(7FؔaXv[sG&?N}kb*7\}O愫V% þ>еK%J>=.w56]-8 bsl u _7L^c"^hϥQ&RP=FeYs B1*Hյ!,^Xֈ6gv>hEs׷m}NWp:,g~a gRQi"hū@>"iVV!dKAd2)Y酼8ʟ"/CgGdrǝ--D8cK(>5!LqU r*d$("eu1Lj9YlhW ߣRUΗ4K !6=%5MQ&3 s&$&H(QEf-1n%/ش‡i BnKL@h&>W&Ap[Z72(MIIҩl7l'i)3KhAwt-p]t"r"k;)%-[[_px޳:iqDG_LÎ̭q)?5u:gm/H "ϊU + [Rb'3 )m{7Lm(l,!;k-X5;o)0w#+fk[ԑ<c6[^ h\@6Lzy: VZZQ0!V7߯-i7yOܓ|]lrcmY@x:I{sT3Uy9bWͱ\ȃ :|@Q*x%MnU͜ D ԕ{S˜8QU^{v[>o!za^5<zsr /i DfhsSNF|QD1_-&AʘppL/lh2t3fQ{ 6 RxW9)?§Xk%'_nXHG)_3p<Z i1TU<-t9K<TWRA2E  =[JW#ʼnPZw̗O{T[N: )8r.F!>2pĢS2-kBؖZ79=B)ZuRzt+Ey/Gب\rLiqZ-0  o^njCiFy=>2ҹ.Cv '[jxKuJ zTEz\qP]ټv|}%vOiG{l2FEYs7\"eJmA:}K:Al8ڲ65#feBZZޙ DNC@@ăLY+k'kwڬƮ)۲tl6Y{YSuY9[;ܤN iAEOX}]8E2ua<&"v'ĹIpL) LWҞ3]LUiyZ _|pi#5M>AV@V! s)lx "hqblyR%I@SsbO(PIe+{HĊ&ӽ _[OBTF]|}ہEҷ-W 7O ^b:ޝ\TR]SJtæ|9د"cl 1V45.^z^t5{Z\6]͂pEZ[<-V;s{4%Ikp^?]ir{b pS/j8(@+Ԁ` Cr-L>Uduea;-(KOsaU3HEې#ce7gc?ݛ@fXO+ExF3ׯD+jT%nOgkGW%[XWw$g8g=I2N''$JxXI²;co򚑄2r%C[(f18dav1O f!}y︆d`@Xnd.# 9h-e12IaX\a :D&n= ~!mo/p¬鏆=^*KA׋oLdI?$%KncTM?UK<]VT=Nˆ^Ki+y*Q.` @,C7zuBz U8@îRmF$+~P=Vhʍ*zP/UQ/mx/N2Iyj>7K.g:R 0*g\rMY~il_MxĪSrPSwz6c9b Q6@['g(WZ8DmkIz8^":y@N> \ڛPay~+(a]3DŽ 9ݞ nqwSwVfj92DT1DvPF k8b~;d]~>n.!NyN7NXəC+T8NIQS`Y0?4 x<'Z7̃g!mDmm6ߑ Q쬣?h:il2vNR? wϢEQYN,Vo"~rH-ķzte>P7ϘioΊdXYq[p0VkWUtڰ &K_$k8d0O#VneYH36`e. )2ZNf2LS~]@Ld*Jq7wE1-S &0)xnZ{DeYJ], A-bt?H4/s+5iCD9ڴ$"!Ղ@UDm#r5VY5?bkwp\|i_91:eM4m~2@WꞁlZ틐Vr+S#Z-^[s1;QثemYeֆ$9cքZ˺eM= ""Jy\@ .lsMY#q3'dy)ZmŴ-IF^hFgmwp97ĤՌ^U,_{ܳ[ǯyTM'Ӗá5<\abcP%:9;ӉK}*WP­3`Ŝ(jJ:vc3%ޫ$(DJi}f~s4G1x"n<rz<"^Ֆux371|;qˁZ 8W8SX.yކ>MXƠjD!E8];SZ]O!ﲶ+'+{_"6@ cpZDN.᧩X3Agis$ 7 U 6ޢ*$EtQpj\ bnIH_xBPe4K˜\FTQ FעkRrhiq< CӰ:5տ5<)J)79[ |#{N9X2O=xp?AوQc_;|0,QPm Yůh{CM6gk uZk9>gjc:cY[.[|Uۊ9'a%9IOeUN97%|\-$_[׏Չx"e1/\gUjneji˜n`U[ %b%?dw}Zs,pvH[xr|S%PE9'#.xjy[/jm=jݿ!i<4]lmuS"l% :^hh^ԥj9ض3t"w݉e dzv~6CD],x36H!&V>;[hdtٻH{q d|Y,> c9xD$[B\%xLGԂwYlAMk2 `jP_4 TG2¡p[st?pÑ,4<qqr1g.56W[yJ忢)[HE|ou|4.X|$^s6lE2C#v/^X I/ӧ yD"Am |y̨,̬MHkU]{i%鉪Uo*c`YO.ӊ$&1P/* _l4 qڞx 03&<@öAoްRӉ p-bѿ*pq&s[n)kŻ뚒ӊ50NC q,1˧ʯEϴ3T֒=Eʳ _s] ʞDCheG)I oT?NbEܜf+'}#hX<'{NfHs$*'Ofb:JCi+ά֯cXgd2_ y/\"çs T=u^an`. ґk# ,hs,׭c/K_jsH;s]d72߰Eΰήm{KL41#_myZHTm v3n8r4aᗰ3HeG[v;#6_֔>!IFQG '|6,܍7Xo`+.8aycM}M?E$D%Ւ۞M_M=.ZT@Q(KC[Kk%%ɪos<˲Khhp+PlJn i;YӎLucuj8R%lWf&EUC%X[9ᚲ~$~uۖ0Tq,D]S䀡m{W?Dn:V,QW N*p}5y HQD lElY  ɳWd2DPpQڏB=ֽjښ‰@(={zW7?rv﬷@c />QhxּĽqqѻ?V*w}Pm0ЀJ:# J|)|)ǿ*RKDžQYk(PԱuA=- sIfXX@x?X<[Kz 'ᖔr"^lQVFJtJĹHqyB+h PE+(@tjp['y `-J9:ޥv]DWY94AK+EC>;z\5G?Ko 9 n-,@շ5^"0u;^=I'aEI挪(Wζ@_s͟a8+ A e5mu݋%a3mN&Rjoس?ϑޭg5hRRXL@,L u`~p),?CSI[O܃|_HKES<5JE)q@Gŀ!/S oz.A9"*Za[)h_1pl@`ڞlHR7x!l~敟 `sYC`OItny)ՎQԦd AF~+Cc9/NtӯܲavUџ$MWM }ō1hmohF^*; q'-oܤcE[BZ[5)8!j RkIT}):Sה̨]\B`~] 4if$"׵aR?\]i1`qCC6g~zsə³2_D2ܪl~\ܟڀVCf?/f2]INTx9"Wsu.BuN"*Ţ}U4LN_ψU>Ѱ$%&]*_u7q28}Gjr442/%dt2m qS٦#;WC37Y((Z_qN՛oKc~V9iP0" D729X.i' P# rCpRML޸;a7ʠ+-7c|\LY05|-lŭE0ERJ8:t;)adsNr j,܋KM3 g3l+\do9 c6 ]]7 rPݰ7sƺtl˛NYxnIFaxKX9|ޤpL.6"YƯ\fbl~#W.v ݠly%yrބöuW. SskhnsY'{[̅d6=Q20Ha `Y2}z-j:\Qw(LkK܎u3Q;OX-_Jȵs,ӢHy_al+I1\vX8Ɵ?3E xn>P0p_c4ET~OSؽxz!^߮nYn,9p^ƸiiEyS#Ui1FvHo6T_?SvSthfցS&+O(1;cQ.a";=JDPDcL&aH'lZ}GuyC cfBׯ:-IPS}*}!G{nu`Ev쀟i4i- 蛨I 2@""'t-æ՘Gj1#@ffkB p͢Lp 8GVms\iiIIWBO2zig?UYng`N,DLs9Vv(ؐN\+f6D)->Èj7zYO3 M3v]@Ĭh~LcptGk4^ZbEJh}]K'eM=ƧYI/ #b Id}H/0,1hg*%X*$v="}U牮ℤu8QE S!ڑʉ!J%x-荺j8FD q`5zkE!sLFI{ML&ًEt:pbi)8Ϥi/%N`s:Gu Mhp_y4!i2+ l4V?lT4-w Jj?ƕN @hQϦ`RP1Ȧc+_UߗTB7Ia -P` &h ަ^YvUYTWv-sVT+Ť`()z:ܚE<Cp BT_ "U/<,V#J PS0uF5E@ Fr(:Z'NWW8\[ P%BI m,3K2i+a) h^VS(9sP.D}ƴ%DfB+҃ -6 ڪ K(ڛt[ַ=sWƲə0M9fmS-E5i~[H3NKt-dI:;D&:I4PEJ͛$n3%lO si9պ11BR:`.nX?/ceDh#-/~xV/FS,jLH|h,FB-AfC"49<jY2hďlBV햎PY}`4щD/P9[_񚏚Ή!3VTSsgO߯!5҃N,MC,RXQjT_Tښfbe_OJ{|\]EäۘɊm+>@3%io}Ԑ{@\ƭW}YM]LLyn(0rQ>bFH<)(K((pHOK P%:HBOTg=/v\e )/HŌމTyjj𔎡bj"!N}ܷ! vG*&)H!J~NN3wA|Rj&}z54E=sWG>Rm#,RQm:{Qưp>mhVɞ/ Gqr Źd*G>ꈚ!wM/U?mvtKZȴ*;FQ3lI(Qe'NUܳmym˴+[o)>3SF&׺n‹9@-Υ/C>Sc%R_k!xԩBn2d^0Fy㫀h|oڒL6ǍB> 4 6۳+ wկۓݏ?ݝR,R6dvCSO\e=~|?2}^k[Ez+Q f۶ xޤBB%],]`4M/%Cw)XMiz -J猑R/ܴ łb掲Qp5/_^%reD]}&g{ !e 5"b(,CssnօRї+cE)Jzo^.Mu?% ZN{J1FWś5\.9(*7Ǖ#h5WUL:[%ΑHۼ|R2I@wƷ*X[J:\ר ㉙"r^vۘ[z1:._%DUkv 1kD{$cf4a5_V}ӌCSNp0@jʭ4'Ua([b7$ p& sn^m7&9都،_cDUPlZ[ʳ>${;^AǑnΔW{CfG Vj<0AP\2{#g? `XH-)7ٲTvTo4n/iL >f=4k=Èkԇ>B R:Wj??8T5ՁzҸ9Iه8RRhLa<g-Osy:@Ɩ^gqɽӵI%*/9b{V 1]-6v= 1 r}ʌOex-HS\+MBɉWPGIx2^sMGO-V]UD` bOǞ ݓ㜢bZA<((&)<I/Hpq++Mt}B?5XHbcLb\k>Ex@X(eJSq!dUG3OMRiq |-!at.B.ɯR|])P!dHTOk$'QkV:~FnⰖmU W*qCZ\k>E #ؤ'k#t]6M ^qwQXoM9CPAQ),go! X.zZ,. ˈe1e*S%^[W5xQav53< 'xJ8:b$W[Tǘ%-HI;Ѭa4²6ܤ8z0҈p̩K{oU/w K>R,VR;c=eNfMHNI?=)P7hkʔ]i"r:3S8=3n뼝X6&ՖO6O]DRǩGvT[UCay;쩢}.g\ 8^O(+omd)Ke/Ψ W @4)q&*KJVo''7F)$b4^RuHUO0b *vc& _'ddEP[+~!nZ}A`a e52$mGhTuxoHAR4F u.ؽo {A6 2:JӘ;rZ9C7h]]yz.olcG`z&y^F/~Ƞ_KAƧ fZ:ol#fCd$wg)xp{WJR;%=NH9ﵽFI+dvy ֻ^K0Ϭoo;X2 -G4KAĝuGZ5uQڛAmY@FO+/2vgrZ)*8߬)hR89\` $u,0(Ԗyn5bcr*bc('X=-%@gdM|eODs+' VÓ˶z4oПXS-տl1,ddnc ڌkwDu![M2$sV}@P9x4xKD1QKξ;t0;fN Htݰ 1}-_Yv,}{] inxuQ~LzC;5j_:O᳠Gʗ *hPV5 ohiT$ǯU{O`[|qmWհ=$|w2gVkiVy4AeLRakpWC4tzEEgvؤ2yA3T8#)RbGaomUCuHa!n@ȍV0OlVZFkSh/9L6A,Q>ceZ(kWaTw)."1ߢnag=c 1 R&!Ӎd%WS.Y]-㐧qbE($L\J%+49-MQ蜧H}1HRڂQɀ+CJencJcrZ٣}^$?)CL~5cMBɋVJSk`!rjY>E]Ϳ hC5d-~sޚ+2f;%l<)P,l\(N5زM1bǬ揙Lq8!1,ws["mqO~[tY^]Y|_~kMlkd&g~(5M'Vڔsm|2[Z]-j㪭<[鐟5 j|s$N;xGݮ^Zs_Z5PMYԤ_<]q(MO>\_HNW/Z7Buvff{R9VܰK [fISB3E;F<BBF>F97g9 .V)mvpx"#nɿwqN-U5UqNs\PBQB[9zvfA4!k'VcdBuUWC~&?ܭ8ktJlf!Çx%< U5D@a-{Q"1uE⁹&)?Gϳ7bɓ2`b<[X*v(4Y%bAi-ߠ54_L1ӑ~Lz e $Vٞ5=[TĺnqA+ ,} Z/xD@'ʻIMPO;k( XnfȇE zX,oau )T_[# Hc (\8 MҫH7ZkM(K|)G^*QŤbV1Tڂ<(nAHPX)e";F~ 9 ztybTނ4]W@̆y!R[sdz|T&{}0G= dgn=UTcn`"Ahn~k{/} }Z[i1Xsɍ PSeWcsoD>/Dk:=*lagzN`CCU+kSiտ< Y6QU/r,gF<'H IoGi'UQ2PؚEqmђO"ٕ-`#)t˴|7W2c4RruP>v R*\a|k(㍇Wdngt~_hרZahGHU+]5T:9HcG~MLߩ]B5r4~ΉH օ/Pf O(,Ϳ~*w&{,;>UϔRؿyXTԊG=d V^0"@2 o=VL2'\0} Z.D"O! B!悰U )P)sy w" #|8/Fs6 |l9WQ}VөD]3n$3 O fu[}M:L"C8fXI]jczI<8yS);GwwtƱx3e᫳2fשs6yZwx ԦҩIC_MB?H)]iRKx9e= {|e i,nAspTY꬯jzb1|#~6[(4 [`!  ."2.@HHɗޓ$$0PԖ{VQfHXlSD3l=;92v^µŁ`l'ԱX׊w`5qꨣڌ:~!vbht8x\JpFG[zP9P=V!:[1^Lע6cTDgt)egS:HpK>\S4փ>jo8D|(-@7*i cAx6Rw Dv_+h̔y յKCF'6^8I6k|.,jU x4>40wPs)x|i5t{.ڰ{KJ :u[p \A Jz!`Q,Fiٌ8D?GHR; [vq]'UNkB%?2/N,w.i$e~ ֌+3: e.BC1'N39OP;6Mz%s5[2`eSO)YZ6֩2nPDYY^gLGVɞcdIvuxn~ z똝KvPG*KsPydI=X&(I6SC7"g#]V3 NyjFo7e R 2!]$u#?*^M38_O/hPyn6* nen"°D shF0hÚc^'ѽBB-BP ;܄)WNܩߒ(-k!7o<&X7n*,4z%_=^ I6"56`F_T9ܴGsXoM @FM1  %Pw9'{l=nZ ZĪ8njŢx\g}/N0NXe0Bhp]*lbNezW,Q򏐇ҍ*2er<+b"g!L#@rH H4TGDR*>]&_ e Kk PyP*Vo致ADZAZC .Bh3U0oPWT}wwI^8QP@_M` jݸb{?0Qe{DYP Ah ::*o=,:IsE3d=XX4?tS땏TIoCC#f \&IdR C&X({%彈>S©!JT*Լ»gfDWCJPǚ5(ZLϒd(PwȪ5hTwTSo3 E|e8bvmrSe{9#Z?Bu&:f9I2 ,,H(2I0싟"[ȏX>6 bsx杴AWV$|mٛƚE<֋)zf&1HD7c #Xn ؍k"(oh3.w榈gF&r߆t]炻S8:c~_X{}[i}xLJxy_FopAhg,d}'UZ8 ͂Z1v4Ա6I@SؒӁ0R;`m4} lQic5O򡖶c0g-űZ;wN!\ҝ?l !uK7#ө&n (m~RʝexꟵf>&|Igg 6Ͽc~&BNŜmȓ7`s2tIaunv:c* zSҩ3 4ɛZmhe7]I&Bߜi$/P:7ji<zՂ O3d{4ycB>"FMA zK@~ ![Ea[mkn>9 |^ *Ř#tÑ}<H:S`9̌lv>h\4pEqyIu}^\2agYs&9~DV =W?8K{Za׷&[]P$`)9GݒFS6ИHzԱJl_Zp7',n)[O:kL8r 5l6rrK ȡ@}Md&pJ]zѺRU*RD_UŃ/y>y:?Z_>;6kfD>o]BnE!6oDYb-*c,{VU DkeQstl5ǕuRly"1 7YZ RR V=jeپp@ݶ]c 1ij@#-+g5n@&efF}܇)2W ~U^rViĠؖ?#SNf4sNJjKtrBs1t\ Vn-WT߆|pUa%jq.>!=NϢu HٯڥJ{e^ 0)A !@+b>"I$uAQOe {CrIYlPfh.<*4M_hAtr&Z^W,1薔#cƤ!F1G&yʌEHbh-¿$V屬y|,} XG]ߵeJu{py5w@]lq kAWy+ۇOy>muIMG<[QgD[0nIr+gKs`o)1op؈{JS6G'2rc%ddu*I[=*ƍ u#jM|G+Tk*+g7Ls0U.lf!9q]gAiӂb1Yrރ^YvqM( Y^;嶧^GFxIZ*)zE b2Kύ R2J7q/8H;2 ((I ˥y]qj)[/V }P3oppsq~ǜP<*432%)m2sx}y971~X|),4)sk>TQf}-37$ö˲xIb4OxPtmNXUiY6^ٗ`K΋Z]I8XԩWsߡt5[ ;|?ݐh1S Q 5#A?0M:Bg/t]ڐfbNB(sdkBEu8$FxM;-Cfr4v0ࣰ@gVW]lB+6~ƈ=Kchۄkz&{nj&92ڌ.ՠq]!T!_2ؚ1SQp,a>~~)nZd|,&-AB "PwWl( ,Uz 5K%!DYE]EDVPOt mQqAXx̛7;s9|1*FJ=#ESkh aJڼ AojJq%{Zpr?^lTcOVIG9z9{1!RSޏyk\7(I&dca0)>wM V{V+y?JEVH3\~;~FC]I<$m %+CU8S\ pjƷ i:T 7u8/ -O_zil,+'u^|,%Sbqz1LFt!&8t -KVo~N4Ғ B'~@ u3j,'Y9 )qs~n ͳs䖖')r|fql6s#f!xyu4_^O֐#&rw)6AZ o, [dm rS VY< SNy>wp zm9 1\09Maoԝ>jjXd|nY!^1GXYUaV(bpm߱q<'u KŭabwLf#fA 1 @(.$0cdJaFQBZU{c$+h&1Ľ8*cA4S"ӻɺ&nǠ8[E7׸m2{¡ 0\½ȏT7> &Qߥ|> R#` cjmZҒ՟U**ByN,GQh<*.{KTmI1i!(GAO!A,9pyqX)0qP5T Of@`ͯ8h+a8 @;48:/:|@hx^lʻ$6Xqc<y/# `}ߝxC!`08b1 tT3J||5=sEI~*(8$K6#Z<+ųmָX;{'WI6FjR;#sCyvʺ&+6(7J7-[s~k?P]r]v7ir7Ѿa¿D`"c͟[87S?_MiX\FZ#P#jJt QSKրvB7K/Hoǫ5L LffSV[uVC-6k!7)!NjZ҉LqrF&Yk{<@\+$;rH?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz ԉCpu>#%4cV5)jjJ:6.;s~jj2ըVCEJV+ǫ,o]i 6(S{.}_gH]W-Pđڬ%AiM>N{+q&CUro*pHh m7:BO"xQOi a;|q7bA'):8%Xܯul4 }D0[~->IpcOYd1XF h3SB4rE:"<;$;:ׯk"2wP\%U:%#y+hAZqgwu" {^!xH_m0ξJʹ(%@h3ҭyx 1@]!],\~HJ_? L@ M)LD"%9)ey% :h~!> n`NN<ٵ/?Ss{=ᰬjxkz^[uIN;3є=&^<仚 o҂WxM<iOC/2ECm*wdJ'ni}gOٲx1X{2M+HIP4#x06fV r]2&n2F߯dV n;ʣxfI;Q5Xm`\sc2EAV ]+< =.ಈKqytHK?dy]D{irn-< %c4VlsNg06Oߎ.'p dwIsmSzWzWc (e4VT8k^ԨxD͉I "ǍLŋ]ؐc?fljj5[c/ ʯ]1GjÖNgGW,T$=]EN:uİwv E{䱙6Chf()VލLu&oޛ,fR@7W}(\N:__zQ> }3;/e3ކTgMN2_6Ç=^9ADUѵ,S  ׂT]DA`ATT%L3Lf2i$!  D b{}z_![JR?&Z;AHQan@({.YOwL/ W qxTd`Tk  18mL~H nx`,F}/ék?٢ɥ<ܧ8d~G% I=='o\*_!9&(=zN4脹QQy,\e;B*LM//eG9?~?&ʯ -8QWeH. hU61f`@T'@@qˀp =­ ځWTz 6_B6P=)O-e7Po-&%x[A/ɷ.'c叺O( !#9KM?!׵MځZj6wu1g+m:z G ˷ˏY<"ExQtꁷ JJQwCy}yy]Y[B𬋆MGpm=>K;9qw 0\u^>>P5Pޗ4d},..^Z)QQiZokH 0Q@s4rStvse<:lPYՒ&JȜ^4lM^1>Q#f/d!rE@*vNCkVT4*HyXG0L&8c;2: &w<-xe +3lX9cŬ* d1zFzii0k sʮS&0g'ǮSzO8-1vԪ{Xϲ5'&'P% Zݵah~Ffe-:K"D1o{|s6ƌkї2V}Jn-k_Gbʼ 6O+*Υq݋Ot7hgݧLK`z33tA7ʘ")>]UכY~ECh{,}4~O I61~W2U.Wg z wr4)6./s>LwW ^:9ɗ:- $ s\tPN1~C_Eb#^a>녻\6y5U׈Tw<)5>kN_*0`Gk;e[eZuNdO7"&ݵA|wpL: V^!DL:IT- ˯^O8n,t p6mreYME%wHҮS&e6Nx&Mƀ 0s`R#4l'2n^M\34\HW҆c 8a8m% #(5&^}?q% |^_S&5c8KS"C#%%{$:w"Y @'\,U֭I+Wfy/J깜3Y#q$tkH #ap%Xҭq_˾Llq~zv3^꥘C>e~)~ ?b#2i7 T~-u\ŮPC3%yZhWr 0 Ulg8YLGBZ9@sʤCYxmԁw ݺrUO\ATDN8I,~,bFAWPeW3rReZ]< WݕiD`6pG,:l a'["[):ZɞmTu]RrdZ!?QipvJDSyB$#уQke7ֿ-^]N]mcQ{vWQLBc^6IpgMiK?=9`Un뢊g$ܕKVp jҙk<|?wbfĩFi ȫi vX˲&e#Z3Mt "hX xHur@j{)NGoAe4deщYZڣ e"J̴7x;buYMI :A4M ce7F XZ1 Jpa;-6{\JdDӎ aM'UL7,NnfȺU0*B7K8- LGA_֍ɏCmɊעsO 3~6lMs8X?נ׉X2c B]UtGݡUJ9ܙJ o>.)Cd%ޠ:V uMt лohܮ=ߢܘ^HZHT5&{ʯ |D=๝9_B.R?vup=oiHӑVuGU΋270=[Ǟ$2øR>6ǦV\l;Z܊V +Kv6Iz D[BGZO7e֢&[)\|Jd('Քȏrv!^!qKy=#ksbh'9rsrY[klʂ4jY8I{P,YM⑁ PƜEB@J=GLu,Z[1?+4֩}֮ZFOQ-81Tzw UsZf;9-rI7x8.ԜY~R8Ѳ}" %Ռ,GAW"VDD_d5৪x CaB=H~m?xH =EKEWOTv>}-jNH0sQIFa7;&1{'"kz,hV~}Hr[gǓR[[=P>F*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$lXP+cu}*C+S,A@OB!@#&2*!Ȟ*RXQkN=%Ȏ &,1j= 6>Ǐ@3X-䬛RK>v'A5#g@x+7w~dCZȟB|s% 1 9ōA䩝SUYY=X3 dgcL3a ͺCnԔyr lf;~7ޓ~~5f$|ZfDu`2@$\]G\@]zTe 9 4[y#'LY{@m!c>zn:> =.+E)pmp'^2%"qJl?o[:x``:X%>]RC K_ 8mI :u$iG@3zs( PZOr_xs.M"`/WS$nw",8X40m5<ńo~h n}DnaϠ+lQlW^Sl,]{ v`(`R顷Uږ6H['׳W6!EI>_pz)xxcvL0bquf 7?jjh>?^\Y#ʯG)RBQX ~F8F_D<=v~մgԦ4bDFzGv?VBa_݅Jh3Zd+XlJ˵a?wJ3AjVjIgu>LeX<R0EcrCBqf`cǒ02`j;1;/FPcqh4$p/)_uy{Q4hݓj|ۗ2<.LU$i42"L?`RԺR磇@*C!`(`@,2Dv_/{ @ 2]ZEWARSx*dR*WSq!Ѫ`$r"?lߡۨ,+@Ymyon-rI|Ԛ:Oe)Cd>49l'C{ K` HzZiLZsz.fT";ib-2(!-htB  _a' am/ruiP[FUYtc?&%'#'19Nu#7od%o ]#k7ak3RLhUkobJ2m% }01<:E4q2Cl^^)iZJ|jlk;> OP|"Oƪ/kQI Q<_CUXyF|sM{v*4UWp`H 0 8Jm?qWߞS|lLwy ޙȫ NL헡, l~øjb7*&"4+\rT'Vn\5.q`&s S.R kICwv&[r{k\(1b0@5l@|=:s|ESҮ(/c[e4Mty^@8uX!L*<$TJx4k?.3wjnItv& Mҩc ,RHrܥJ]2`8ZDЎziX{!ZM)"pWXtly@@^3cW 3Z+mNƊW O16 HOl> sC z!(A p!UjIRU:=ح.?\jDtE"5c9!ه=0 /F3h8{24Ulx @ڦ>_L֩l-@]Nk GY$"N (64{/ׯl"eGeu1Y/ìD6J*%F@M#x|hUGZ-*|>'叹5EJw Ty[uG)P*Gb!#a-v~0w[gcZ9w( eU2CKLM+2sZ*»as̉ͦEǟ3pG(]3o2ڴjyoM.}]?ڨ \4 n;b~g?3FG{(fi6-Q y)d2'ߢfX!:=\dLׁz|WcGcIJY)Ų܂FC"]AErrz{0j2[%by$(=]1l _dŶ yBsWܩ*pǤ ,g,{?//\~7&(O7Q r# jk|h?|s.jb6P^$@gH4<%"/+0i0 =yA ~'Y NxR#po=F͵ڞO-t&73<á'$RM»"0XNG^1D>jhQߨM}&ǨpjO|dh2:'x iT+kmc{d4.W}iK?^-H,Q.So2P"rcWz$ajUNsZ2i󺩢qe͑ hIGO^)uԿf}C&=44>-=m0 ji˹|\QXt:!ac7P{TN[\{$8nh/ymp] ve5"1 ԇ[SN[Z=E1U( A%RV*Ȇ ^^{B2ણ𫟠pZ'Qw?ⷛK7Մ;wb] Q.7 f#D(xabaO"Fޒn:`VuɖTUUNK}!oOrJoaxA؇u/PȆ2-6]*[U;/reU^ј /.TklO"7{77T4^uo ?yi|Wɒ4}Z?K5ukqrt-D tP)j}6N_߳Tڸ4Iq2VQFޒH@&5(AJ)]?E,{zuq yɴQti_nE>JEWT$mT- bH|apԠ#_RBfxS)yka ex()S0I'b9F`" {1ϫ>ʑ[oc W[YޙwiP19b$,&ĀGht~In+d7*' W<̓'Hfb k| %c*p } d>_RW2nqQُu5f%ďܖ5b9YŔg=0^n&kk;7O,5|Wz/é/O앗1/˹x%:Y0 {XG(U.vabYG錝=2 D^9'rGL^ ;Zc3z7+g EHu`V5 IDI|31vba0fsq>5vGYyf?B,ѽe91x"wԲ`&`h5 f0ظAۣ]SMC4aZQIPD" B`Ic͛DU֒v#(snQqƨhM^{M 7nJ&*^(,Y(}ctS[WU>= ЖRl'[N]@X{χRzm0WIGe!Tht7h=¥T/sp% k2ADotm 4Py3#+: Ͻ؇eHqNC%{YIp؞ M+(z|= PW0aKFT }r=,Es(ŘVE:Ȼ?pT,CV(fiEGArCj$Qa_}$՚&Zu2kX(]Ϗ /&ōt}*vŵSk̯ޟaIVLB8疨/&ጥ\vHk[`H6VM9LV*Bs6+8֖D~/B&ItЇ^mܺ<'uݴk:=`QV 矛L#כrBR?8Ǖ/' "{ry&p6‚ykey[QzeQ_{5GǪ|#>@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]#~a&uhbIQ;5)t'VAZẀ|%搾0S#Vuv?aboUsmDցzA6 hׇ ƻ%LP()HPu'^hvPءlDntYryW+Ŵ6x'&ғw-Sq4¯Th00"7 R.'|aO&>0HS#ma7CG|3=7fx[:I_ƛ[SK'fAр/ńm8,po R-.\ [&g(ǂ\/{,` vbLT53E7\`NE^'[ϮVvӌ˱:'SQ1;Y!%f&]r}0z[5{rKG-Eؽ%݅!t2!mjPwE5;=~&HRߣ[9t1]8tslF0KꋾѤ[Pl݁P[ \Z\!֫MbtݜGh.3 ݤe t e^VAW7G<{;!5JD-mވdta~g4Mhw Vkٍ<%C  HtHH3@6! peP2箖墦!Hy]'N!zAdUE{ daOAy~W2+yzx5޿S?t7 #mE%Wir=#^+#>^Uu{ޓ&o>Y~<|Hr7%#SRI5(Eΰ_hwPI/6:%[?!.`D\bBnHjc(x8]+6J eAF4b+i8&VxqS:}ۍ<ɾI-w;@&@[Y%sd4(aBTiC0IvRNt>Xp^4$림r25BhBT xG(=?j<@-h5-Ά1J8)5^6JnyE UD`)r.6 %'IBXEuǏoF_Y2 ;+CitSttKn:Inq;Ԯ >M144b3fP/b$׌Zp 6NAy$Օ2>XчdmpG|j3'l5X)ی7=a/)JToKOӯGI!S~5{X!FM"U晚!(_'* RKQb%W!6Jӽȶ5T nQ *TArNr&f{.qM LqL&0N;580]aBe cJNZP6f[(V2T Z[⢸Fj #ldb RŅZMzjq0* UQ,%b 3!=HB2ʼn n-ugzTnRkVA^BEp꡺a5+`_iiSDOG@r|12LEjPm,X >^{%(㐇j)~4L@}x!YDLPu&|:41L!oΉނym/4t}x2a\D@n]˽hV$s3UmIX E^a'LeW NmmioQGP}ׄR6GrgIoFUٸ |Mvb [|(ߖLwud|іx\"qmw(Ta]g@5:^A D{l%Gly/@bjDؔ݀:lK1I%P&Er"=1@cJ:G$x|@෺z'ƛ;NP);09%*P 0[F]^k~m(WmяMQe g*Vsfdj4!N̩nOGjmA8!#)9ʼֻJ'SaZS eod+ekٓ9CHL(B,6X uznzMA*\_OZw%A}a209Tw"G(>bʷp0D7JלX8e~T.¬0~{=#b[1m0#̇_g=dpbܦv/vӽsa>c|̝6 rKm"V7p}1]"%prږC{+uT @=-)fwPU :@b+[Y_璄 Ϳ8q5-,rXd]]a34sU9T/[y9 )KsPת Vw5/mUZ /VHTM51R`Ji2Tud\ DxC|եߨ:msރYԵ#ݵ}\jb17U@ZGf&O UxftpΗ~H7qN(s~;}!^p}x5 GwΡO=@7 DEDTK)(.UR ɔd&ɤ 7a;;;*SAdmw)k{ Y<]%t@,kM@̑nc}ORUoM%I2;5kۮO22֠0}(d͇7-ӒOg`Av=u2"\7!s799x)gChUI!_V TZ8\ x545fl)w񎤲bNJa}(П\XI\t>b7XYR2~8<T5TpUUK q}#{+yk|NB[I i B]e$5~kh2"uT'A)bƐ|Ϗ-:+<b,tDyI;Lzۏ77ֳnFt2+J)O *Sis%zagQ{p&%pV#/fCҊ/[AD][@ ]eofj̠O>+i:%4弭'DUeQ"h_-$cFۻ +sֲX;cC%gwb3$s-[r`OϐV i DBƃz+)@*sG,#:jg֗ߒ$|tIC尞yP5uTsYmg˶;K7?5'-qhuw~Iܲ^ƺHiw*}݆<f՝lV3_TUУWB- :v_ oSGgn8}=2oNw3# )jM . 8c q2 'vذݮhQ v^uw7ok;mG  ;#Cz/G`&0`CnqMP_@]j/;`'?ciwJ-?/L"=[DQFࡀO$FւKXܲ^kl(72"/4L~[mYeV /(Mo 4+1?("$Ca,HX"E>848o۴NzwuW%Mwz mKKwWl/*?/(B/ag}ADԁ(/W,kvkD嚔xUI5ᨳ-5i-LN?{GjkrtoS]sIMHqWRͥXeF XauOs~q.~,.'.v̼b #%vZDUEiF.mmXJM YKO-Yht3Mp;֛\fT4w;SE.!J~ٜ+ 3Tg8~*`-8Ov4 &+ODչTTBI~ɠ 1\"61zlxbAf9tű\'G7r0:b|zE~fS,:Lm~Z.OJ،%ISַZׇ 1,"n-(RD]uZ4I?f6ϓI2ktpW&ҦIZ$";k TL "]Q69fܕjCf˴qC,4J}O\E+ ]x?<0»kǗxظ*O2ezuS&2V􈤫+hd& W粗uH/l16Nl7 ]p}|lU$巨djr;_֣s}@}x5} V:QOD4 aO#%z (*D[0LBof= B 0Bd6FTR<=\`i8ZjveI3yqƨfnw޼%{'J _X3N-ލ}wElg)i=3pb &|ײP^"#}hKB8m/򻄙Ebov%"-{Dȡ@!5acNm֓;bEW=EEwQ1_牋}+{OF$m~HXҴX+NMDKzW-I _[JL%k?zwҾ|B=3R{aHDLk½KȞTK}x*͕}Y>ރVՉ'sPF arʉe-3{yh+gԝ:9nb6$l`-6LK9 2G(k7%u}bLjQM4yWPD- _CPny~3 9[1הeʞԦdʤqM1jٛP6ds 3p:2_[(dQzI^M,)Ǫ`1;,Iڅf߰+ BkXnXZV0%+r34ߕ[IK265Eֶa:ҭN"ذ BgBS_5Ӫ8CT=ƕ^Y].@Ǻq0y7\U&64@r9ʥlG>·CP7W7Iֳ!|L} a Q$<4t &14$P,4]*@qtZYr_D #nǍc&k&p- -;\T.Ls^Ӭ=XRcap|n;MȹsÛWR􄾜֢6{:~#x,aGp_1OE -:WhRϙ57e2guc# Ǚ*՟Yí+!{m]& ᜬ>6-/%{c#neې[9L@Cd4S6͚W ZFsϡ|/~ !g'>C'G:dTna#| *J|X8R;H4гg +2~WH0G]&&%bcQO\B6v׀QV#EҨ]4~|3.ZgEv7HT{DJ[; /2E:*?2]u4<"?ȥ:)q=DGaW◃da V5KUB*I%T]A%hXxU؝yd}gDP+.~pLRU< dPhz珪!΋+i{[U^<:jӡO x@{$h"WơD%,tt,ͻcdf`KI" .sϩWڞh{,-c(kyH^EL1 y{d79_9+Yx?|\F%-3Ϭ̟XH)["cf]k\dqcxV?6>Oqn"5f+ Y䯇w͵[i1BHê'a"_?::_?{p9 ],P/e/Y8*݊o,B & 4_^}$!>ra9ByGOpx Ng5xX\ X InW ă-0WXsd$i4ScbX>uq9i6I"N`ASypCwhxY4F4]6mU(cggxc5:ͅoF R,.aŔQM,i8En?ҝ?!ÚGF$NE76[◘xx1),5G̋)El `#MIȑSAy9=h*2 @0Cay-?uF5הǼkEc"x0%zӽ !yr$z±ݠLlߩEkykxESbQl_/`4H 5%Sn)@$XٮC-guc砑 zܰaZÅJ(J9WQXDhI+@E LhA|ؽ|*<|D7 ϝa4(DÞ 6ua ?rQ}NdƣT?;)IYArCOB_"O9*ԣۇުeE%V(0Fޝ^ F]*a=RÚ#,&AGlG+`GX̱5ƨV̥c7R!`)rt .5vxAL_bYY'Lb&Jq K : ٙd'{א(yq2a7Kj36)x QfE4WwSԙ.T3r<{W  F= 6}G6ݡgh||9Eu;(ݕɶ{?y/ёkup'᧎}oQocI~ki0ʪhJ[I;n$e]%tHzgtnv&6A%f82N5u754@KgdO~Csi4/9Snا]9y7~GƺѦ$$.lwS"'eQV%TOym+'cE$ʕ$ ^QQB^]-6Lj:l5}YMM. '\̔b=daBeHU 眛 %b5?Б9_m卯Iu.Q)^ƿ+zksm5fGN:JRIi:c}wΦLe}I^6,*-z>%X<=&=f&b$zarw;f@chvp u{v+Х6cF ~9lҙh5H#Rh9}.3/N΃@a.gP;)ADwAnlgr?Q#/NglxeFC-0O[5kV\Tک/X{IϚuxܩ)s.\ ##G3a{q P$[Ġ-xN)OS !іk-h1@Ou9=R'hLЩfJb($i+ ( bW6Mrd'\r}ȀhZţr*BH߮lHZOqĭ~!*%AC {k!Lnt:򥃕=טOKl$M+E9S R 􁐿VC>uM(4Jv?{AEBHt&@Msp)( %ӜP3Xkez֗"§6s͟Fc{RH."#O7Z1upDp@K>am'fGCAe}cX:|Jx+~WLjm®H,wH@5[UHRPgMǴP 4cMnܙ~ZC> lE8x?'} :遲;V.Ncj\DthU&ptW T?Ѥm(G@ENux.ls 6*팵aai85Ts)S-?gOĢt78#@ox7~8D\bQ{U0E;C(~fRH)mс@b~uϫ @ߚVEGSojul6Si?*Bø;UJnv⬭6]g܋l0zWy7=O,8C= 4Na\I[-%T)m($[l(+0dj8J,:wa_5c3"*lcqq^yEc3حm b4"}I@zW* qK z]Vc¤>EB)/A{Y昖)yn__[NQStĮSsts( Wj;й۩T7AZzd!p^;VmJË%zvM'f^cT{oȲXׇL V7!^tjT/h\'M+9T%$oip8oPW^ OpCϠQE#7V e94|uJ3DReb ^BH(~kάe՟+&IUطƕٗt=)Y ޡwD:%b!$gF<{|5bW;F!QmBd]LDdSwb [b3(gYo:@ƒÀZ4CYF>a剺v[_6%SiiGc^]ap;KF 'd܄1UOg^sN [iMY_~$? c!EUaExc4ZW9Ab.h,0X.Y>=4<5Q:ݏeoB]5;Kq*V7 /PW%=ƈһ"aY욑?pIWFn^|r g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t@Sg`ղTcC)ʐ ALV aPA9zwXS[Zz**z̃VS ]r7O;lW ~xL/'HhwGH\ŮP<7CUXy96`Ȅ7̨݆}j_, 9II[O@M .hv,-B;,Q9]U a4tNNv3Ƿ0/2&l}R|,sd6*Qe%LYp!=%*:|]|ӿA=b7 L7+ziD-fU܀#Ogʤe =<}* `<bo4H[ Z%}$t!~WY*ѹ$׺]CsKT`[fr;]|K qm\1!7mFCzaHO8!ۢBgh tʼnPՐr`>$N3WujKB-[$9TdbZgsQ3){甎9iB {_okK]-~wzy.Nė+ڋ2nHZ\;a'fër,}9yqa/~`וֽƹ%1xaIiS>ģ՗y᪼}x2y ϗV؟mn&}1|R^Ǫ܋K:kk?Le(P"[Hs?x6@uӈ;)oogm#0 2׬nu͸ nz+2cœ]zXs^)<(l#Ng2qඉV#.|ouiVէ5Y) Vn9K;!V%NDWji?<kLX}~0U{w+z\JMBGδ;ZA.2؝|ւ;s{r`lj uAV_Q ˄Kh?mezlPg/uxQny|"_?=Ay"IJbSh`@U|QURYp[WЅ.Q^Ut4,N :-feWݏ1 _2-֕t |2CloTlD^)eG>:TXOdet=~ $t4^e}'RG3|w ׹䂜^iHG2Ʉq2ݙ"YA5BV,\{\_Rr><*;*>:θ#{^+f:PCs6d5e8,,XNӏ2EGUHBIn5m/=Л)oN+Gel$Ұ nfBP}ʚ;JRRUŇhvuEvo%{^;0aLr|0^%7ULXP M_e/BLm\D;6dY46otlFQ:ufEO771M)չ5ɂt?j1S]a]LXJDLKi3cOU! !_ "g>xG=iu#J26|&Ue6'L_Fss*vp}04u v*CIi!Ɗ" .JA̗3^{ օbEzr\Uj{߿Jo=-u ++q>Ou&]=TsV\G;J F0iYS0yHw ob<ƑjJB5>;T 3D˞ 3wKHhYiE\6+>UdG0Fym^#:kyQZ`J)3AÊ@H9}F{:RאSOADvZZŵBg pg,VFY:{Kv,奨]{x}wG~ozwo߰^$JhoѠCɇHgItoV,&7D'@sBO8AL2CsʡݤwH1k M,uDK6~\K"r_+?8nB@O^3=&lƨ,_\MaG1,C)ÿA(8 \B~UVHTSb+{$=BL.1Px&1ЋɿwXsz։i;ڤ3ѱ~omȀ-U ׏RCuwqWpbu.o+PX: 2ҦpVv|[2 Y&;] P 8EvgJhռYjrk}D 'rTs)$JЇI.t #۵0К(w>n`A NaX-STNHzN7 :{t  꽭Yw J] ֦g]_W[Lh s0 A)iSc@ qn)N|bj% }ļE'$8ۂ}g M-4{VO qt\xNa%+c f6ҁL uDxI YTn32f8rܣ'L% Tܼ,Th a| ;S|E\dD\)vmyxgyK's,%y-`#ڈ-Z&ԤtPUu<3T>^^Ӌo] bkҠH-$\wahu4J5`JkJ 9-YٗfVaj}aƃ $=.xy%WW Gj5Keo,J!Җ)ˤM)%k "١xO>W-'fm1`*ڮZ(-ꗉ,ŭlXw:eJUC^="]NFHWpևRܪɕV: B2lPRq(2IDw B 98r;w\5I?vB7jª=l Uit .= ƴҘWOBte.񭹈]hA#0_!sKT@cs|< ip3< hl"җ9t%0=5i6@L({|"l|=ZT--,Y}זTAn/UoL.BF̎@8/#N&%eDže|Ԛ.priK_>lUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5m{WX]eGOsCX:}6R|t+jOPHFh}A&|1>SK3m3<]@Μ,_@z.=B1OF?{ۅ@o8gݱ]@Z'j@tڥvAvˍ' OG7\_ږ}Ny Yx**n=n$^p?NiyҎ?hZCRr-N%MoE0צ,棞nuST_h<#޻!bq^71tq)+l55TXF/?5r0jӏw~5`>2uc)p*K֚fS*W}R#(8s*I SQ ;^KE<|qg79b/a;rcc>ymv ;ks=R\T W=$DE!A$K?弓|K ҥ6At&& ~@" ]ꕆKΏ2VDQ2DqyG+=}r;v;M'4w_un#o/c/pCpfΖQ=kCA3 Lپɘ^M)n{.*#1wبkKʝ28g¸׿J 8ߍ͏F1*Ҫ깵N ebam.P:ZD}`J.#9 AvvC@5ޓǴӼÅBfiMb]/FԏiKQPk#8P7,#.F ×Z{^5JgLHy(n_Mê28Ɋ D#ӆubQ[GD ԠUh4hsTP0RLޤ.>㿰#&Sd fPv>%WfϳhH10I#+&tn{.]+<`29oS7,TQ[Ī֔ZHv L[(1;*NvA并KMUuk󫿌;.Iw_ݧ Ww?/>&:x҄+I˕e*nN5դNvEiU^\;= g v}*A.n=Exd}"_Q2V8 UnHٵf1)2 %#itM(18IXOd6b*XItS+:JCs~NNq?тT#pLXW?;4NLM A,3xIpOKP.`?n9 xb[6jUrt {eA&ƔdA0<;>X+n3H WD | )Xw~&0:6Ha*!2#bA&H)m.>kXoFMi]aL,~<3̜&e[<qK氀iiѸtQu(q|+t<녥eUH`gr<5 6}gm}*?Ш++8C.LGIدhQ(\цʼ> y1H, Vݼ?ʄL7 -ղ(U]>PoKi^<(mGq]5:+[g=lצ@Q͞pt_ ʈ 98=a|6Eڐ{=hWhHޒ=]ՔnxTD~(eZ8T?! |oߜŚy&nPZ8SZU2UpP>G$Z=sAf՝Uqv&'jl¥ 3H_$U ]\7;@φ9QՇ~麝ډ=)]\UwS&[K VwkG !.a)BEaA^C.%./ Zs3 kb3OL "ԥE<c]DxL;7o Cszq|w/g;6kU$_˵xo!ۉWnx! YY8iaq̰M53%qʂ|NX9>]kO$ds n=  Z 6dHb@ 论!(Y lo|,&8neq'[Z:Gû$Ҭ!PhJ;j+6*j"[{@Z#Z0S9Nz?+Ue]E#CҾe=L Qo8y*ˣhGQ8oIQ+ͺd*RMJ4d)-e[U2e+ bUֲ&j1zhB6m &.VWH= @D( T@@@F;$!|L2;@wEݥXEUA-Zz]oxr".l>[nIM[= Ic#.=+) ԄE>!禔0U8)!R0&lIP^xM*rȸ'#pS)rllB6SWX4 \5'kW9[JoG)y %;LI+&k&V) xƛؐ@FUmA/Е ˧a'#edS,ڑУk@ks=%O>lLYT% 2#T>[ouʎR=-B'w65\c2>c:lm. ZcʉrA rR/5>O}ǂ72u1Sӥ[Sf[rH/nS*$]dƫ\v hnMm G]݀w*psJN&O߰oє>QT,P:DWKrԅV7,NS= 0+[XZS=cލWEԴPs[9++f$w=\ٔɡIp1-HEl^)㲾[Fc)#gTcfA2N+V  Tq,GD"1{Q2f/9R0Z0X^P?g|%Ouy|sD&1 ҽRWv`-tATZ2"}+:]q'@Hzu۽#_DX[CNqރ";ޱ;[T7ekHy[>K^H{C9(W?'цc*uT5gl%Β0 hUK._d$j $-4k+}htŝӜ.lfˎ}H7>!Ma;+;VWr'IӨ_?^?8l.+#9"C!c"C$ %cqvFCSy2ZnL%q`W88Ndbo/uItl,4ޚSzb(v@]巽JFܯU uF˚#ĵ&L[vBϕy6Ur ⪬.?6FPI~o)x.$uyK8,$O]ϫ3jZkzKcuV{vii]sl]gaSŘ+lrqeK %p^tD W/kNoԕ anh՞IhjWrL|+LD?o:wQ>/ʦ{\cHYyA6 [ UfZeҩ=j+7'2m=ʃWY]+ gY1tGt<@!gM"$MH 1L SaPXW"1)\)|+`E,F0h$EOk!!놚<ZcCgBp/^; .^ډK QWIO姬 KlG+ءC$ DRi>7v7oX7-x[eW%iÓrZ߇S7o䏽.r Ct?Q/_l*/- Z^f*6OgQ GeH"|ۉi\#$#XBȭxxOuu{mEeU*G>h:h>Vg'6+^hóG 1pXɢ<σe´pSv1\oMƵ>Sg QYADT@fߕ =Y)JV|U~~x&V5)Niwimbjh#b/#-d_o'HEB (~i|@_ho$*7ATN!@UP?x D9 5Lͥi=^%;24qw 7$dJ0I`j\#0 _'uwu\(5o>1jJt8wj21L) A"HQ!Nl~GASMN!P֣+H;ޢ%R֑dL-Y/F7w-^9e1{Pj49$. V$$(X=d,D"#WdB Pښ3'KBUʞ h=Hi44GbZpIˬIYcMH^i]swƆZ3 [O֘[ 'QJEEL F᪠\| cN.<0r|dbұJɧ*KvM RezI.t!Jln:u<~Ti>iY0w>7>S5)_,^}_yȌ"KVbNAJ_3tU̧>~z[sfxb{wqY^Ú YFsGd!uaeh'< Tj&˶MyyH0{u hQ/p=nD3fڛgz485ڭ`,n&l91ˈn ~ FA@ L#ꣶ?aiYG NĶ7n k |vZMH] ̗ +p387G *(O\+ۖى"2.&Jވ]],tES 2/n-x,f,?@/|&:Y+zJ^-^?gcM1UOGpUb (;. i@F7Mtz(8c/xxI{G)b-*wEreL֞5/Lw|/YiIv)#!KwkᢈD"TaP\8,|џK5tWRK;+ J/?Ѳ]V@1&j$)(#|/ <Y®0m)u+G}dUq]&uuVQ'!- ("G_|INVAeUQqբ(X@\-z,-/̓ Im.!u*FU0k^v--,ٖk%4k˸Ymz| jCO0K LDPh5&-,Oc|/Lu:9dցD~` ^ b(ʳD0¸d&va9b9 ̾}_dp3 6XCa뙈FEJlrDhJS7[wJ\63B63!&itBP'.Tg`wVvOcsP?IA<ق2 U.(-&:/doNeNkR.^dr%Xrܕi;qr_pRF ES-I ;MC?f]aa~};C֭O3Da:R(Jugq{YϔPXihp6as>5n&ا YB>ڱ5Ϳ&ΖغZ_^묋)|jeӥ jp$+Z*qQUJ Q씝XPݚ{$n0\Jg'qڋSۃCdC𔺥mfʍU?./ϺԴH8'[i5(r$ُ=z>^" /i,'R΄{~SkeNyx&M_FI:}u')aN 73DOM p6T1ѰF=UJc:ц5콬{Kݏ@v lDV܊QŘNvo SY@cE A.yKqMX ލ}rܑtanQlg4M)$13:/yXmK1 &œ\IҤ:gcքp.J:T<&%I&er (J:pqŻwJObl2}gn_ɹ q?ky2ra;`U Ff ')kش-V 0Xd}:QwE4j'C>g,zTs :tLx|-dmf@/&_o©|Wc]bp^K?jJC5I0c.[+hkqGҕcAi 7y{&c)أ{5ћ@)~6s,-8 榃dpůCE*iQ롔QT*'9N{9=Nn f>0WM6j]‡;Dʲ]FtGS7l@eʹF[;eJ$^i8Y*=* z/o Հ.fÔW?Xlcgl| Tr}r* kAr:;9^Rm7`xM";Mғ'*wɱ%^jײߕyTsM&MiNf{pZ0bw'4U54 lI5buT AiUs/8O>O.PNo jX[`ޥʁm.m@=XHt+]"fTNYeI!S:,$9CJ1Aj;+{+i:[4`)V j2U`OR"v v)S0>D3$[C fˊ1 샭s~!)FagqL܊ç5A$3z8NXE"4vha. D=B\h_}<kizVb# 4pZ _Baqx%_DsqףOس"zx [;VQT]5D- AN?g:5g4D_GdABƒGϞR׎45B"R;P-W 2`4dVAWFH>{bNf+Оn/]n8nj;ՒرreP>ieMwH7ݔA^ع}Q&=;4oL_6vF褭&()?,JEfb_M#Uvi۔GCbZV[`>V^*v40ɨ0l71P0V5Lݡּ[y<݋P%>͗`,]=?l{UC UjS1]ySq+2d0<1ʁNmΣ;mRDZkjT>#@ )qQDHWL2 n^IVف b5T(]"z8-."͸,ûIt|J%(ׄTyFҝ2d>XH=?E1~zh5ᓊ.sS9ĵFi܎~,42d́qz 9b*"e-'hEX>>3e_vSڱ.$>_m8/RH`8ʮGH Ur?4^vYߤ`XJ1y8k|)0NrQ, HZЏ(جd}iO_}! ?a5 ;5$1I&nesjn'1n#ԽD93aP:s"`*V3Wjȫ . C妡h|26aW,'qF`M:~ +/xq.~ͻ#XqmY|\lp&)P,} ~Cv$eIgPeYch];RYPTzc}c.{a̸|}[z_)U]j"{xrG,m2׬|ӏ AM>V(нe"Uh 뗴;u;:mhƔfnqT>|QTf8ÿlG<Rs̯5x(`\vY^[`]RSVb): ?3 #:,ΉvT=#]-@7wz }[Ej< /4hr; GdE']-Mk$W`lJp@{a x1\ub ^V(7i?ubcUd9t&0a7aWT 'zIhkl4a<$ ŘG]&}M~F'F0סqP, yBy47 Dl~Wg.cř!J#Kb BVƭMl_ԣhba]Yc7/2M{ H< "51wѥaQX5Igq?34;ƪE=Lm:N?"\g4ż%"xM *u`玿rnP/gl2"uyiRC{Ao5_8"(wn+W,?ʻ^W}ڔ.CxM[[|d彁,ɦsUՖtU_.xҹ9YT6A-,4]\3Ͷ4 *%jԧj=*x}f\NHL]_՗lv4n]t7u[fypyNQ%0jIbM >3dEtj6h;_מصU6\i>iL@bd0m_ ԉ_Sy * !*IDp+\\{oH<Npj+xUp" uc[uտ%C R: )Z0v.7m+`D1K$5<LQ[B |W 9ҝ'ikQzGv]L2{fZ6S5# Aʰ|P ;q`BS0dKG,_SMd5y@+t[cMJ XCag2`Ԁ7EV!l.DGR c"1!G+@'u3X^ O!:,u&W;ymM_}%3M^d G~ W]?@4P<- 5&Gb0Rt}'4:?:UGVjD SveK7 9!zERdNoSckzrd'BRU'z!*"ӈS$B˧M;bokEӼy|}I{fk("|O"Y ϫ[JK5?O> Qv=7dhi/|ph̕b=qm(k ~5)8Sk[Z57_W= 5bNʖC1MeX"Gո +U4% ͘$du-AqX^_~=ҫ]+SF;,|jVL@Ebq[Jod-Bgl{=%ɱcmDq1}4Bvʔ>J41IW%|Ee_/Vޕu~)ȹ 5<"-s3ߖ>Z2zɎPu1Ҥ;yt(#,"!~Pœp#@kg^0ʈ`7P.'\xi69% źLt;OP0鹪R.w"7p9T=FmM~ikSg-~A+ ѽCwP|%4=B"Ce6̇>B'p-sџ3шSV{%l"uV+J׏zI%Mx:\6玬rN{Lf˛8aQRC[o^ꥧY"Ѩ-/rDM~0KH팕ϲ=xײi٣XI{HWZn* a8SkJ!6 x>.1ц2I|m&!{m4% 6 "RmH&b9Pljkt ֬Qfrܢ4f8?$B,hnx4p<:(yWD[ƨo:9ȾEͦ!WDԉMz69f%!D>g"%ĥ܏ke&i5aHq{ba] zT*6Edn{C\Tk=*@$v1Pn(tl]'|s7*Ζ. }2 Js*oSC8_Ikϲs_|ØXiyRVt[,JYE̔Wf+0(z35c:W+gQЂM-iʉ*B6Hyy[@!`"T\ *sUihjVRJSWw3nʨX_33!/RAxB?~q=QJOM`H;ffXT.nYLDVt`FUe[ >YtU}5X86"ژ8vu~|1D2R;%_|"Sh:f m;'Æ JJn wbܼ: 0x2 ]2|N{U {OT qb+FEcH\krމW,$.AP>/瞒HIS 4f4۱WX~>f}( ⿑8/'rzKrC%5[ Zeؿj޲nrKY`*֞}e &U$+@d]g)?(iNG`,Ct*GL~k?oyyzZЬoD|FY_gG8@f"8L{Aƨ*[Ԝ7Uj/0HYb$4삉L6~5HOKL@< `h"I1TdW@m0 `Eޢ\v$TC4?w 3RH<AlS1K-(Lub&uM=:"Tn6ULwv @E6LPԧ$|`>0=]?a!o$ v _N寛)%rz*pQrKG(7AbuiP3 bEG85 uTX ꮘpPxT)R<ڥBalAQ?`ְf.ы>Hqۤ5#Xycny: 5*f"*tP aKؐ s_areE^EӑNt;F"ϐ/'{{d2J*weTsih{}|H\_=K0;yæočdq[o&_vΩl]/5e*y9Uimkt{G}Mć7hø]]SܼNnx&S6՗fk\|^ijC/lS' ߙF@5HYEѬV 7-BB.{$Aeafd垬Su~,;}\6vaMN {짲kp; U}(\Oq*6A(H- U?eZ!ݤה3둗]X(BU̟q!r! N)dRYITۍyYO!Ecˤyk4~@ne1EZ3'b;) 8F5F-`2oZɽx!Hf^&ƨdت<*HA >1C0A`㌷t[1z& 7.}=Eibΐ٠%]3`:W) \a7Tv,}VBHbSIFb|p4$3 TC֟PBigU#䈰] NC7ja[|r kFJH͑<-/1zBIWVMDm)^ͨ~0"v]AkWF7l1ĸeXI7]҄oNGmp?ޮG7qqԿ`ҷXz4\[*x.aP:] )Quon,T2M^j 5 -Y뚇 IEDD&؎D!&T1-U4)6\*K0MeQO!0}&2Ć\= nX+ v[(rлOGeK^mZ8ʑG4Aj>Sw<5|$1*)-LR#jKwZUּ,.PeLs4r$3 Dc({%BzJccfڬcv!si mV1s fgOfQ ;%)i z,O N#pJ;rSN\Rhbn?|~k@0VŭΕ!R0FdeȔBBwo2ZyQTZUԁu.,ru?~wQT_eg2 .1$^ZHuǴxZH2\6?UJz 3t3dzT5mد7olҏL.68խo,*a$<;U-kf³̳L=Q:_2My!d0NS9 f%Ena?Ժ,| hpMjʈ HyC@t 1Nր+L#l^s)]|+rt%aP.K?R-pp *]ZXO@5иmC'DQ4+sʽcu?нU8m"Eƍzbe ⊫ذG6Iu3ЇUb Ԯ|E]@SX@Rj!GV'ܖC`P2*_3". Aj03j <^ o|6XazGrx6oD+Eɥ=h[BkI6쁦 PYt?ҡns󪅰;}I9OԥT򉋁=r/&A儿 @(즄Ę>=m`;Y|b[rw[̓/G#Y 0'+|@`?81lo)ʺk`Jͫ-`#-Lts-DPnfՌ Rh,R{`tgNQ7po]\oNkc?k%/9b!8Ǻǟ=r\A8on:Vٚ}!l_)Kl DYΕ7ck!fL!m|kTr$Wf4 *btfyZ%Zw6sʴ|悒6JMsro`||D]p*3gF'v%S^4nN@8-I^ӈ }(W9X2`[~Tto=elKVIȬoU_S.ڟI~Uϗ7s3r=m3y?|1~sO̤lL7N|6ȃ QL3WIY iё>mZp5@ Ya$7HGW^4x5<*G҆8%}5'd]X(Hfa(3"^ߢ~{ @O3JB"d9'@!ŏ#"y{ɘ?*V\3F`^bda Fw, %&F>_3% A(jiq!0DA#Xbfw9|aĽb 9KR!ԼET\a!!7A'G^=o7dv`u'5c.pBȨ-PCJ-,F> Ny\9CC.o?2Рό"{k%L@x *U#U̿+̡>Uy/# ޜ%h(+"+) +sL)k zG) <`Y$NմS]L$N"(/3Ql*Cc:MOmm-@Su_%MUϸ8lu)\3l5I*:VPXnknߛ}T` *@xfɝ:> U?vqŧ;ʰ$]kk]kmU5 ^hȧw=T8 Թ|3V+hinP$YkŖ9ƿOU7 ( EuK "1 2aa_ͱWAH;a} ,2wcBxV9 Lj =`| O<fasGjmJ"[^Ƭ?ApuBWV ¨ԌeF^-Gr'q cƘ{>Ljآ-mUzU~ҭձ[Jz}6[7}E'&:ۃd9p xLV0p̵X?Q2UE[+o*~(ʜil77Vo񼆴Vw?T{0ʗtf̷^ 3Ҳ(@SQ&z[ a.ufG2|stLJe;VOXJdn9[iySɦe{֗W(YW-K+O26>Шz`oNh&c ;jaSzO$͈ZIUQ;,@cSI[#nU_+&!?J ]M{&~~ W27ױBE9c@Q?+F4ޛNl$+P|JjxW?"J=bQ"/"k!SnՅH'hoYo7,W{N GV*H7rs4i=_AWj iKԙJ),MiE=C*XS*{Ee t:`d 0O뚁:G @#AR8 R=܄ s=b F4j/".ܻvA;H @RNYnh$54ņsӺgj7fv Eߦގqߟkˠ׻ DiuY5a(g92Q^y|V`R#XjJxzV3UBo*6&Ķ/eonnoYэT$./Fgv9l=G6ިQ7Ȫ۔)uj#Nb`Poyd"X̟*>r8P.u6 rwWA~k@\YH-d(2j"BB>/;!JEjkQi[z.T] OXBڐ!vk%^?˟oLc'7-2۴ՙ8Zcya^&Kl >z*d]wlǙlD/e=yXVjP^xacRx{jPD'C&3ZVZHzLH53iwړX1mWmUO577xFKM܇ȴ,Ց?|]ONkXAfHOZhMR'Hcir.NI:?['w&wvKOWu;)wמWOcZJWE i3;qŧ핑30j>uCgI\f>^ ЎOYVq+, rySpL$#'|*;O*F{uF?H99yN8O/pRšRD|ʫT/s+}(uc@<1u_`F38I"#3^(D*+ܫhXj\ @/ȏJȿwRA]CR#8"N/D/J„e\@P[)UqPNPYu#v'u崳 9SxSKPQ9UXU0əR a!Y{inqVw릜5;-M1u@θnxO}=>ˋ0]XsL<۠#kF(eueAպn~IS% 3NK `H(BXӃ} f*R@QZJbsUԅ#o# D,&dHϘD3þ yk-:X|u7\@p䶹N F)q.HJ6F|J˽ ҪjqUUJw=E܅[Lכ6c Fl%F@M,X#]7u,Q]kg%6{8oyZRh J@m]E檖xJWGbj$Z`9wI;u bޭfA2_5Ep$>^1ϬI+ 1π2-K>N~#+;㾭uueV7QJӠR.~<`(aHru0 ^HYɟ#/Pp"V=#/duKU\gQ~X%|(,+fYړu>~NVjfʸ\[ J-P\~Shem^K^ s%vL}W-:SNED)0p,M,LYQ K^{ʬg\XEYZ=Vj܋U_}%Lk܂vKP Ajj)!jӜOu'ѳL:6hQ(*7{6v ԲW <ff6Ǚ_HcEҋ9dk} 85k *la)sW/]VㆣYšbU5׬;|Cma0Gi ~Эh aZn?" yMP$2lž%fRe0qBm.MWkĆݦ5)yyneKeh |1DA_7>J{Y½iP7)'V? 3UH$󑊇ʕqp@t4ԇ3ݾIiPzWiN4S+o (U\=purٿJPWy ,Ea\:Aѷt݋ j@7gQy^NKfEk/<;C:fD^0>R &9Dz!L&NG4:ѽh)QP@ͭP+%7ЁUZA.-!}μyXvnJ76-I6\HQKV?+A goE;~ )AeG|d~U(1||D_,@6=a-Cl 7T fkG(%xVøoQn Ǭ\Re݆zwme:kڤ=[`3Fnܜf-k^ +:+7͓q~7y˻,¼6Bm2,*Jo!nٝgZ'yEK{(wzen#FFT^b)ړk$ƱT"KHϸ]t^̸ҩ&f"mdar NӋrc)Ndla\6- Ofƭ>cF4~:* 9R& _!$ָycfa󰼂8|Jz+ѲfqR6w8G] Bi$ҿ >wsHe+;+]=Ίi1hTY-lrl|6FƗ,iFE>roy:QaaͶя=e"o- D-Ԑ/❴_TQ DZxK h1K g7 ?lN&E-CJN$I%O|tQR^76ѧ0.Sy΄0Vxi𪵃SeW҂Ю8jALmzRS .*G|\ x'I'ȪP}&-Y>Ht"5"7<%5JQ>RBR20v"7cS0W6l mxvPQGKzchND2Vľ`o$NU:ÏڧtEя zٳ s7GP΢X/?89RK."q5r's R|L6pX߃e[Q qP?`BU~vT{8,S/ k[iQjw|aUѰZ."8*{Jw6 R8fXFnK]:|7MlELu乱[DW1-rd= oެXjo4AG5^ϷO>[ts:]c 㗢m/%nH*~є:O߱?QvԭVt1gis3$YV M^!ɽ gU|hzR8j:iԝXaɼ2C:s'Aæ !j4՝Uqb'n4:UL βMfN&_37ZCa?T jg}%T2+֫wqL ][/%30e}ML/e M iQ/V\V+ #uU}9 ,'C "Qyc=S^kI?+cѱ aөƸ *RZ d):d/Q~_C7e\Nz1SP}rETp,h0DcX_ļ88V@ەhcBփB:GCK L+$\e,#%  H 0+H&obW;Ƚx|h0Y  $Flқk$&M]|ZCz$$\$~S>8/t $0g qEh3v9Q*!rgL\0d%A?4G/ǘ;!(SH0Bo!bp\{wN./5a5UuofK` cR p1ݷ 71aݴݏQ9EXJXNFx=4# MA;[F`vow2s}p`Xkmӳ-'dmo=uMBD5=)3ٞhު)XmWy'?V]Zvا u=̘-U^qfB?"%6r}nّ~δՠMr0~0@K L%>BW.~Nu Oo8dYw@sGȔL/s~C^_JGT X)z@@ %NS%7$^}wL%IL21T ) Lt&ZAGj=V\gf2,Ө|0E%EJ 2uyq 7&vװp8 tZ׿ CKV !h} =@dvv!*zUKAAm X8Z)N8Qwh`P\Gb44TnEY7i:T(;uWmqƭ7AdTq&IzUr$h|!or,mz3=h멺qv"gNt. Rݼ.Sy^eLbVNm=ZTdiZ^a76 x^)^hƥ{|F{ FUk4>,h@DBwB~Q/mGcrOpGuq^L90m5YJ9hIFb\D'l_$0tWdnx FO>FƔRC\;NI|W|"0UJ"Q wdTbPjˊ1|'r 򆟨7LA4QТ-ek7w´_lLPEڠSC1U}NA ͚49h3Cd>ЩTDS1|ּ$0PCA< BP=xFjU9<8 7 >ʏfLbzH)-O{ pijXڳ 8LpROMXWyb2:4ÿTC`-W@NOT{ v7&2F1դ`BމY .&=Gt,PG - |. .ܫCL=k4҄$mŏq1Ec#oڧ a%- {ֈ&W&hWoV._QL?k*H깺-2L }2%ln͈i[A¤S݂FwWn@#ګ陻VTO2wMX&HS{b/.ifL t5dqQG6֫`yБ;Q`/%Nj$1.ȫׂaf895:Ktg8rܣ~6dtQ}ii4["YIV 6Iֿ Pb5 QMSEHEΒo sҖȇfLvٸQ սQG画!Κ \ѲӏuKPݤmeI4= b(rdQ0d~ qyOPÒ\5 qԵm7/}-7Th:|X}.O_j\mg@?Rx࠳wiSfZudm,AL?s_ `XnR܀+iPC(wm&mʡ>ĕmBcGOK(<=9!J%>솜6n )RQ8{}]aS&P;y [fs[* ᮪%Œܚ-l3^dSkvfi|W|78qmw";%eg0OJʇkmOEUd%-1En T9|+NeN *:ݭDaRsK!"՘w 1djuDvI_~3|S^kRZK8oF[f*ƃ"i2f=1NJ# Q+,$fNZµSk-]ewtts:fl8Hc0_l}{Pe$ t~O*lE}d=ML>VG̨:W52ĖqRØJ4Dϣ_!d%q!9vR%-P2w|$D%`,fȐk fʯp1z6_o^`n|z(Ւ/M? s)Ŵ 2D]J3*B]T^ڇ8\\ht%rQEbߐ\t(f'✷34JŔ9.`p^g{y4u-3LjF倐kfUvW+MW eWL/xNꖻ! \# XAl>/LjXj\,:@f-ճj_;q6XE%“Yܘ1=ʥTS aM!q#zJ/@=Lb6M[T1 QOTر(c 9qb1m`QDYMl݆P(}KĭhOa/+KK*sk>[Ob5 )6JEE&f8V/tuvAN ɒ~݀<&CpKKtRKI24<B)YK1x# ]rSuVP.ee>W[ҜymHBZ^c7 -aVNQ]WvA":m v6 ai C!ԋg׬TB1AG.зrBW$&]غ3UMp92lMaVIsuTƔ([8-þRd 3Kmo'a2-\/}|6?m۱,DZ_خe9OO޼쾣p;N`DǕ.͏;&u1\oM&FDU@8$'Aw@PFHH_/Hqq*WG롏ł8N Q} DۦtcRb"Zͤ-+?b=[#V[cd 4r%>v 7_?=`.^*g{d+Sզ> ?VPg"c4oJ*kHc(b鶎`+{m"fUq-µ+NK`HpeS^dɘ&q^R]p ٱh>\ U鿧O]]y:qNRQᆎ y6ɟZgҾ5=4iD!:+Ѻ/ [vZb⼄ XI燖՟HYXI\$_;j o'Pz´\K}X{i]~Xc-|Rj䔂݉RY8S+AHGѿ@IJLˮ+PNi]$`ld/B/Xldv~㨞te&T듬7 3)pmF ih.p0,?rMވ牵^D諻 ;5۲)5 JNF2('FMϢi7H"Afs;Ծs6(̴"idج(TWְy#M Jc^eg!B V ?ls“ٹWh4;Gg;@:2k˔E\I8{R^8^F@Cd(h.%``61~4"^au:u6PWuWsV Z r]FBM'& B1z>2!hD_cpNq PG%R|^08V*4;}XbLhOtGD:m3 1CbȔȦqfmU|:MM,uinkAPyX^]Z&2V>BZZ,Nj\@園A) |F嫇I<=Nx7]")Xޓմ2dS]:?&Q{CMFkȨ+B?$(qyu۾t/q V,b H5R&sdSJk>Z*irm gsS{7]hM7e!͗Pxey+8WqRg)JZsZ6]WMZ9;hVXcZmQ5[F.s*Ū@~sdIy@꺥T*~ O~6t>Y0C7{a 40F"TxLAnQ?#C&67]>I:yI"/e=naix&~ZS~eB,ӰRnўe iW0wBZ (+zLҴ}*|)1&=ŋh(m Coӆhd0`0=16]B;6nlU3^Xk.19<\bFxTB~`K@}5y'Vz=!0BƋʒ= 3!ȖH og0-Z,Rp#UU)*'N՞ ZW-G<Ǻ[=Z+][~=S`5S);z6 C䃈@M蔷;r B ]Jm% بDD5b!P>K sxJנg ]%K3$]iuѧҽ'>*fDsT1 YdB 6?'Q7j!,Z-c0k +'kOX[T!f<75?Nd{6zmC_cSus=kei4OmMk!T<2|"Ӧ"s*4{S/kvD1f-.߁GkG盉䗹c/IO6x(9 :B++쉻~3xy?P󠑪ͭ0'M' hh'}<@tiTox8h쯯oRՙBˡXz ^i b .y:+W6̮·3yhD6/a{CoxwBJ W.yUIYݫ,Qzp(v烜ޘY_.N޾!a^CxdmA$d',1Usg{cϜ_qb.gm ZKÖeo"._T v6(פΒJ'0c9nȘPx7@c'meZc%7WMEr3WxMe>hF<ԧ0ωnehG.Û-TJά05ᯙ(MGKPyP$uM>q8D$.{(v*rt YOC;ǣᇨ AT_JeA )7D軀DE(y:GI1?qk{ :^KjAd.##ohQHLxs1>y$cm$%cT上n\pyWt=jZ7Ɨ#뒋[ū ,8Yռg0$ɣtê ˛U^>iuت.rbgоfދ{Դx"}czٯ!3*OםP-j6%+Tݑd8Kg><{Dh+ I#}Qc%aC 3F wMHb'rXq88@Ŋiq⮷w8B*7,8~ 6Gd7kރ1b"S9ExW hǢJ2#ӥLC,¹T\OLXb@0br Ѫլ iu)Y_Ev֑Z)pgEgYk$~JƊk;ڣ@"!=|]ڂϙ(a8DA-3 x! OZ3t'X~0p@"J1"E[L;C} X QCTk{ j/kwh0 L  6[6֘,ykp <c>f{'*$g!}ߙCHf;@*~]F:*ZuR8>A`>DnAƑ$A5)Qu#L9l8l9E ;Y3G$ܕ _lq__q6s'd}_[Z,bT⶜4{-ǐ}AI(}Y͚֙m E?Lߜ+^I[CE  ѡ~ˬ/n{6\fhZ*ͺ0wFqe8<`vUhOq*(.59UZ!襶v5)"'H*%J:cuBcc}!yt% 8KVPBH\8GB<騳X7 5 x C!ϐ("",6PCCW cC|&cX\8 xn]0:7,y,YBc(&!%){̤1oڪX=6աcaeHk*f@Jdt BDmQ\0ԔSWmK(5U1ْ\)DQVN#׋?/wփAL(Q-UHo2@I)SwkA-,޽*R􏺄B:$?Q]%eŚ9$o> :rkM_)b؞Mj_k(ҐR(]ԩxBQ q0 kѹ3EDu!ʹ$fS\-T%iGԢΜY܆YW5@^QM 3YT^jJPdygd-ﯩ7 37>*N792ѓ/ø IN<,™!5@)ܠڤÖ7䥪`4\)ҬVMM\Q{d~L5bx &kUC)"듲85_:֜CM$n4e \ l#0t:|ByFqY4Оn<ظ]1F ű}1Ac+bHq N-?Œ'[="u,5[+LU=ζbO5!o׆_|32BDNn b\JXj4[ "RbUi5R"z %&PkpZ<7/pLaRv%V/:b)&%;¹WzP*{Tbf%h<7by $Hx(ԍT)7%k[*qیL]>>b-i);i' lm-OL=W!fcO ri8z}働dFTF3wd r_Ģ )))U$7kZ6!  dwNH}+MUjx'5I},# y'd8hٷ_x.O:eS.|8Okm@.A.k~(rĽ/qb=[lUx셤ܱJzTAyIeUIW,;\ b:ZtܖN;)\k1WVi:՝7Gw]HZa錄+i:M?znW=jNr1^a2] ms ^G4(4nm]8 *u'§}_#QʫݪIa%wG؜1G%}ʜ=wB|NR.l( _߮fBzO%9=.4вd@}~NX7/O ZCrB]MPnX8Ҋ?usp^ٯFc68jHi;ZI]#X7<UX ;ZCqHa{wf6xSkq[O?T4+:U4o+Aɚz~o&hñpJ=GpT:ק4Lֵ*VeT}䥪0gܽQg PR7}e6-c18I ;)PT{uּG;#xoZ/ 0NmbWf|Pq2CV2@|dyl]r;%L6Sm`}o53T(mc38ay6N^vj$֙m,\'˻^JuuRKXe|~5x:j3تݗ:MF^"]-?Q<&VrZPP 42WN7l m1rMȞɬ;I_guҭKjdEAVTujjryF :+7Ab1hO|(SY{}4)])ݨ[Xk@z^:W)HjjIhį`wT\,ƆʋO{x_*<h0Ufפ @!֝쒳+auep 7C'a hO'W}H[E UZUݲ“ ;P_9z& 6RoMfaa~]+J5y|\;nR$ {,/0 !z}M:I1~j9w㪂eЖ :&` <yMXԃy!O`}JgS\Z;S9; _$^7pxWcA=]xsj]U*-+pBk̉~e 1tk[-?^\3+t[j1A9w‰괇ڣdNb> 3y`C8y7}"K,/Bhz;]^MIVdkӚ4P% zR͋0-}F_Yk}絃x` ~|i/|#e9-KžpUmo/E q^)tkvvRI2OVP1Y1J殺Q}Ѵ@=^ XbT! ½onNR s߳3;'l&e4TKxPLUZp _ׄq*geNLy}qs0Һ+Lo5hٸިvC>6i)PjN:GN4yC)Dn!EHEܗu][BH5SQAkaFvh>la 3Yڦ"ciǰYJ."fibEφiQMn"dib0b".)V XȋD/S|"SaÂj='҄O@V8Er0!f+.-m6h#Ƶ (A0e##B懿hn oܠǙiQ`aamt.MegH GG_?-1'6sD53J52`9e` >2o'TrtU'ήhU]ijkɸxშnϻA8ď)2ye @ڵ#pG+;t~5DmWhӈH^naMa j+0qn+8&oktNKÈhԩEqnxҌ ~;^gCD2Te~ti`iByT[>H (!8HCOυ"[IaO3Ofnv[|Nc"mƝH~ |>>:B!}w4 =i?ɔ6;?t 4*-t$\x&_ "1]QtoD{2 Z3 ٖ!?9ж: $Ps"Dj ᗂ۰1g%3q$l4V}Ȭel*k)mDb{ ~|XtBs[ hN@Zø_.FxvH=r͙#{EDaq<(t.i`PX:tnӮ!xF g.z vaCkPg.c@5jPuT/"p[B J*/3rVxuxtc?Țzh9UJd؄،7 @%f cB=h7YrCY6)̈ȭ)7~}ljk%Z,&8eG)FR Ԭ?Y ܷҧlpʀ}{*Γ=sֻ]+] @ffL- ]NQ'tw$UyqSK% ¢VOm'?4\ᵚ#U}ܙsGuE[{ݯtyru볊GU[$/6]7xڌcyH`o }Ɛ`Y /4>i|*-~A>]{ORnu|3f124r?=BBt" ګt٪ L &+?_ ty/ockێρ:v MBTCWQPRqGe%2^aԶDG-%a(!V!ى$g46aD%KOPVd&=V('9&Ǝ8$*#y^?_+y`GI6A#eګB*hboXfaaS͇ pqA37eR[iV%b;j{xacvYȄӘ,7` 6rSp#+@wS8%XBL$cfka\mɅA@L@6}iUh'Q }@+zPLD .|?[bqLL΢H<D.=yF6%Ʋ4`%\;ͪXQmn~10ZHl7ճK{4?V4Z%GЧOÕ{?\IlxpG|<)g3/Vc{U!Q!G]3HU pV0e$85P&N6SK쉎=kw->sE"pHÄ4M*tq\U:, <0y3 etE>~Fgo*۰&6$N'ҒCX; l๲rRW EM(e{O ö֢Yxb?IԓkdV)TP B\oW| L^472V2qQT`){N`,&59bFRMz}pOV2օY,gBϑZ5HM %KP#J +э\f e dyi'-V[WChd&CꘆV3P i`j*Zԡj̷o^e ~r5dd~g|1B LB0blNxDdTtLlܥW^7orה;iMw3=frr¢aQYi峪5/j^7zGK뛷mi`П#_ƿNLJd͓7iE.[Orժx xW]0̤oqfiesgvSS|!g 9IgQث§|sU"UG>8\ddpga乆^\'t{UovՉ}kJE|VҗddCCT08S&r\cyWS>wdg zK_Ai'nvsWfnfnwSvdcbAw`bbj*Ǝ"ETAkfnoՇn2y ԡt>g~n75a9&V C_%Ͳh=Jmn9&P$hl QdOw/x3MgYsgϸcWm8nQYQ.^qGM,Ml}66.Z ,qŚ7/lToߝd I40>ð}\b6ħa,m13ZGuKyO EifQʇPr?q۶vBنfqR`FQeV5ڔ˂}lNp)'1غEDӈLe)0djZ?pF2^ئ[; >4!p$IpkrR9DIgX)YyJH.%= ӽרmuRzY #AE2 %k[Rmc )gIrnPi%uԬ`6ښ6r<SxHڡ7^m0/a' zQɔW0-؁5LOV{>4@.8 <ڥ5c$ok|~y2dVݣ QBGlZmmh6;csqDFWcm0oU)kfjriJE!_,.s(]fnۛfj/QG{Q;cЧo1 e#,XvOOe:xQ¨Zj_ti}CHd!%G(wp"k+Jx;% o)a t^S0=AERQ*(\))yD~ Oޏy~)rZ?Ey5AqqO;[]OLAJC0!BAyx16) WIVN5 f J:m]tWw|%+%eVT {UZ:iOªWCk7E}+.} y!@ot0/Ltv~q|/:әNhg;N&N6k1&'<1 ( ""(*^"xcu}ӗ}<3Oއp;R-Xo7qr0:'MjqJ-ҦW)URÚe[ܥpi4 l Ր8Ȕ#N0iVQQʊ/2fjr2fd*"t:E=YˮUjU? ]짶:+ H>nㆼWGޱbUI=Jڠ(cTd5 f2Z3W3WP)8A݅2p/鄇1׸ܥyvBZ+OWh "yz*B;[Ti; dù2B7x@lCyQEn\.Y2ϼ͚TL)~CQȘm!3f  ag>?Y#DUlX;at|cb6gN&2]σj , !CCWG7DCS@ fkhZ+Ӵ(o ec,Jn&y4c}Q *0XOk2a^+w?lm ,jawW%7Fn6kp˲ 7b^D3. W u?  p$vmȼ&Rs,lx.G<˖G IY\O.<͜!,_`o0IA,t[6 4^yyߊ>]0GoCPP,b(d%kr5AR1ei\< |H%rM 6M.8Ų[ yUv W>&LǪ2Jp +4 h|fuC9tИ0LTdh(m,<<5C4f=)R aG"dXVH8Y?۞췻ܿ1dBc*޳OAb/˩FX5yҸ pj$;茙Œ#1!P] ON[j7 6xJc~h=Oaȥ,9sxKc.rkzl W{-ajTŝ_WwT}5ua XiO_'/ڗ'c ϫ#N9PK= &x֝4A[ܡw[j濾8m+n,}H١]\;~.'q1*6&gɅkre<>Ї-moMʆʀ5tj;Nn(oqʓ"Ċ}ײCcDzseŽ˯+_Ʒ,pǺ v$=6x~uMLǙ[ODئ#e)@ןͿJ+@yh@@D1]|4f-?DLjYHuqƸR1BfH \./U ui4\~:dBJ8T!0: Ee6)k1 KĖNS2/3`K CB!7y͗ tA&<""; 嘍٫En1#cN8iu֙Ng{؂**!JnrF 39rr@A$A9~}<}~}|k82h!SN"ꦈ)@7.x ˑu[2 C5dzDCQ8uW|Ï]g+xBqzk:$'I,DH?HnmV|00y hґ84gOY%>~WYTlY3MN2 cl)Sd죈]TQM[ ~p~0<@wh@ŜH L;IDvCL($^%*ʲR{ɅF}f堎, y&`~4p  @ AFHG24y_#zFeqzBTmfңэRScR&o-ZhB '2#E@By˜댫S%4xUg]ZlgRk ƪXc,Cd OaM-(M~N]LDטĽV1i7CϪ63yㅌDq{Q& < |+">f?,?a6tLj4j\BR+8fz%eR^2I`1t{ܚ~b`@s؄@SFmmtW 3لyܫv5[5rXjfs &2xqJ5g,º Ad Bˉ}wnOfjp0?I7Wu h%+:K,$Y! yd.oĚ; vu>Vxx;5y1LZ@zf*[CCagڬ)nJf!k<;ӡx8b7Դ^QeS!|%L 蹯1qA&PϏ3 t;jr}sX-n]u-/rӪop6f%(ʩ usoN6`%)O.r5z )8~sgНgotR9efO-sO@eZ@dg@B'nԑ8ݞ85@|ܱv΅%#/\_q oރ6a Ɣof&׈8lX)Q.T4/ŲRT߬IlmHik!+~6l70!#PJYŐȉ5Iִ[ %tt~qٙmwәtvtN۪[A G@ BB@ !!w@ B -(" ȯa|k 2]Q%TS)q:@ u~U0w@ LPF}A*ޭ=) 4ofk$j21_.7bHD%iS$ƞX3!C=dCjlD$hF@:% SWOQ2dɹEB~_oXH$aӵ!Voj 'PjanD8hAA :퐃kVųJZrҤi٪|B}<=Ow=HQw5CTMg_v4P::h<-Ɗkخ!r׋ZZtArNV-2vf){َ 2p~  8 K9bh|l.7nIh^J>*T<HFTɒ02:GaR( 41|   :PI>Ws&u>PJL4/gY~U=WnG @}$ %"ҟI$q+BĝgȆKu9&j@4I9il@/Go ̷F5dБ 9l/O}"Z/9iRsMV_tP0$ $CmK @p l @JB KRa(+j\Ce|ՄNAT2$]ZuX4Fjbl(^`:`A2a侮j?]w\"g'cm%H؄7*bg,L& GEw%"+'NcX'gh ;|k}?1yZ=N&"gQQ4eFu2 } ^kk ٝt@#dh:9h /T:l}Ώ!"G#;6B7v҅-錵 vg 4AcJϺOZܾzʶ2#2xuK9.u:P4chձ*Tqle܄ˏ2/\Vߵof'.^>wgٹ&wn6|KK|8? N(&0QxE$I}?[3U3Ő9h#.w]`غtkկ 6)<|^y><@FK§MEd"gZ%þN77}ߵwjǑ+RnD%Wr7݊Vܫ7G&̜7|CϢx(hRZB(\G>u̱,{貫KtŁKR3J|kvzuĒ; ^@PAPVB$T,3h!w >k'~mqх3B cbdK焴Kĝ˙W"\nmJQkk>՛UՀ*j0Tx%b-^u|б]=}zϯ VP28%1fGRخٝӧ&g9|7!:|u ǒHJx'>x^Ͻ ö|B-*f3oFmF{ܕr>ڽrOBz* rK N&7) 0p<=NfobЎofῚ,`4{o/9Lp1(8VBN%Eq&i~`=kPݷWp| K*FSJVz*"^pd&<7ocx5C!4P@٩PyVHwWE-e+xt0$]NIQ1lG5ب1Є4;%#Y)eڹE_N([7+hQ,3m9x)M4Jj^y2%_$ ET\ Zrȣ3bht`::IЀQC=j񆖀sЎaH H.[L|ZaiR6SިZ t i2d>C9ۢPP)S9NsF'pKh9Љa2u[gl57ZWJE*,2Glkh?Zvd@ƋjGMc0hD {5OB{@tc"@8NO2yO[stE&E{ԫS#˅VXUk/Fʬ:CEIo f"l@JB~*—uY -$8EiZ 2UШ/4\*& lflP{p=tA? yi]J-;IwE7Ы1ZQ7ڨ"FJLơrQC7tIQYo Mjh>g@megJ\`<|NLbRx%}c,ZQc.%mܢ)6+fEհYa2{} ;بHbr!} >P?ɳk{K4\iaTtEQ!6iz .w541-MB69u^ϜӧTf0Jr]#AC԰ d:Lw2vO[e+M,.>fِȔkOk9M}m@\>aX[YlWsMǒw#KⲴ\IЄZPC3j> ;HK]L!.bq$1g.5|̀r#Y<܍R}[q&jؽL2^Sg]Ըkk.OzkxZ~=>G@qmMPt)؞vߝpWigp*R\V xefS=Y^* L6"Jf̓w 9 ߽Ezf8s%DwgMaN] @f~(,`OD. NgX&>sMxȘ2f!S7b$o?߾M+э_\yzrt>2 *Mv/*êyr:r-I1MR钯7hգIѩS:ۮ$hC A|m_7g?~xw_?{xt5ϸ_v4Č8vZq;c׭x, @B @@$$9@B HKDw+GD0AQ-y}yw74R_2MR@9u"D1NЅ?67tGb-鑺4q.zSPu`4Xx7vkn׻buuټCP-x^{ex'J$V'$KMŸ(Oט7CAV1yЖѩc];xu١彻IN/X9.`̢R=%zJ`)+O3g*DWTC;^ց/oRKPk(:sF /[aK /v_HC˃it$d+y/2vzp\ߡ=7_ǎU˽pB \`T܏ihKYQ(>ᵫ00dλ(h68pS0K@DQ"9S@/ {~uY`uR.`+B*XlQiS,*; x[.}C8"&&>+m }i68ݬpdW-X ' S6N88I_b>ZB90VR|V]ӼiF/їa dnH3Mfw>7xcS } aEdǀn8K,BZ*lȞ`wp^w^8@:$uU"*h3!H--3S6੆g>z7E{#K{=O{٧ާm5HCҐ4XY eCSj)ytci<~pQ⨺SJrƋ̞ƖFVO6FS]fOF @J@%w3c|ЗgѴr*nYR`!Sc+ ̢fytuKSF[sݬF(kLyH? "P|Ԟv.ˍ&BtS~R26}DFKwjZs8:[RY֦άb7):]mrNW[UfO {w >ǡ}c{zo%'jEK],InfT9֪ NťrN}{]s]l/v^,^oPpd1yo xQף{ײ88bAB:!@B1( % Ju(4I0"XU0AAΞ=h}xm<>rDVIyMeUٱ3G\W(2$͊tR.V)2]v]Ӑ4dE[c:~G?0lߵ3'Nϻ<):X'n7qEZ"4J隂tX%t%뻒]) 8EHU@*Ґ4dB/pd6FV2_v{َT^ܾ6HE#/68"bIsgruLzT*^T(j/}褚Nfӭow~וրFAVYmhQ~J^WKayЂ uHa۵|JP2J] i@쌠s}?-~G kP'T2_=u!.2J **MR rTKJEP3䂪3nedA]Pig҄3p3{|G; x |3_|J[Oz1..w%=.=-jK`fASԭ@:B.~5v?|iu5{emc;;W1xs8u@Y_kkSd4)K|U]u= @&Ґ4nznta8Ťk)_6)Md osOVBռFOk`1[{!/ɂFvD؋qg8sS<]7;@mhND+-O:A&۩A@`ma#@\8 lA0"WgdXKk%ȬF4 'y2><ϼ4=48hKDHC84[px+R}w{(?D68*RbH!i9j v&tΣkkWo˙ښv^LSR=_j5*ejGx}( ("( r ((X'呷ece5~? /2%جƻBPNٛPIPM+eUj(g9f30;|} s3r;:[ t? 9XD*R4=[e4*^i=A[yѝ1eewu̖g}N<@ru9Ёv<)PȐ%w$*W~/E 2p>"xΟKɿt?:NcoUd8D]8:B= z#y}9* y^-XYil|x&A#NJjO%OLnbDqS_&%mCt {t;xGTx^ MBOJ3hyH93d r,_5KRқV@Z?}\ڃ^e159@K@n0=˃νV*QKҴ>N yoXكU+2ꕝ6AE+~Tќ3l$(#Jg@> }UoA>ϫQh|U|,?5k$6H% $Le[&_}5K׫m65Wm! IC:HmZ:n4.P $^ȇ׺+:ԹE-yO3 N;,iΥ BDDԡjyZ5yP(T@tO :4j X651y2KWs TjiszMPM6T2 ~䓁ZgKP0W ^qm]g 'YC\+1 s*4\eU1VXȬ/ \.l0;̬^s>ЁTwמFľͷ4}ϰ%kŴjI% /P !'Io`0Mt04Q[ ݍ4FL/78  :p`; ^#<]Ҿ{'.<Ќ 0G'7%ڴ"*'ʑq::bڈfBi-mtY \f%CB- [ b] f>?vЉfs|ΈtrAu)%hy Y| 5U4Ś&n3=Y3tm*v!Ynqٿ9~>8h?5U4Q}*ϐ4xMhJReMI2EclITt7`TD(rYCkombc'ntS_ Ie "Yh^Rw$+MERw({$:. OTE2.l;X.hi.{kEݍϺiV ̙DsegO0c(vh l4Yty /L!SzA|k:<Ϳ<0-puoZ`_,m_3 +'YW|Ƛ;.{|QJ_8@L!?z@ͅO? KEu r|W-F޻tpbڏ?n^3Xok/lAOWϽQg> i|q1OϒPOgAE be΢>0Lgtz:ֵAEa HBBH ;T@A nXEq_uwT`P, XQBM@^z.>7=y9; fd [Oh6 %37DiDý/B\X jG]Un-uuҎxDx#"户, bAu#v`g9AD%s^&+d AԼJcB̙n*,^*wV X> Λ=k.p r{+.;∐7I5-o"/i2W |ec޲|XfX9a+lܜaxl"b`:͂`HX21]r<_op!`E1]$DJ|  #!߮"U:F! wJ~ѐgl߸IxDG|QlBSTJ@5MHg&O䟃Ze/dN+f'2Bx.b.R\ # q\' AI5?~Tۧh:Ov)AʱV M>K#kSќ#l[ |Hs4# &Q0 :?z2`3Z3xX3tB=|^~C)j85Cd[kKewl=Wݧ2珆Es&wpjȝe?$  *Szn8F7zL;_ڏa44G0=qvvWӔЧ5dlH ĶVP;:_BB!d}N?SQJ #+c @+c}x]D}ۨEӽa>ĽԶq- ݺF^Abw9H=ɋf#j)6+llO' x3C&Ҙ*rG{zb겺Y2n;8Ox]'un&cd`l\% #s#[YU,{q5_e]9܎XSN[\M΋ pnqy_s$rCБw%s: fBk[/DwMY1`a{LJ?,NJU$->UTf(Z~TVj:"c:8j:8kQ1Oo2U5Irs?PhLTS[Pкak"(Uav&r*J <TQzP[/rZuR}jzI\rLӰ( ِe1|WTv?KŁ@AmKE,C@{$0!aeʖ=&,% pJXׁ(Tks զZbI}׳n_N*n=g59}h*SZ.,̪?om.ngyu^M:gW5neε6Y4$iAѮoDh:MS 㾎S <&}%*>>[\\-Kk,bʭ=*, 9yӂ'j;'w' KUDWM4k)Ҏw}+݁1!#t{ xK\V{CbIKUjMMYVkYq~{QA(QW( 9E㢜)Qn0/F dHR jh 𭷬tc5t|0!g.IH]a}ˆ7:5!puzKAy SܙVRӝv%JK/t&q&:SK&EBY SMҵ7alaQigQ'#!X~I8ď+:XYܘڜUٞXSEwLekwtIqlŤ(|C/ Yڛr&8fRIŮlz~Q0]2@ 8A?p'"V_&mKjLnIE7EG-∦aD aZpF6Ȗ6joڝg]F/Y(ML\]"bQ\qCb&VH"مǣcl>_ho3< qw-e+ 䨭B:}{Tј/8|;4鶷wo|ƨ:P<(I8U)IhfrZC$-!}Wj 5Tk(ӥrPOބ*1]m~7fa[(^5\Ű/' W :^O;[\8P8Q0:X06Spv?_# 䫮JM%mozx~]&sk4pmwoy+AR'GMaa%,H)?QX7UW7-PgJ|g.kag:Z\n+ɹ5rC>v<"5=tOt-X$.YѿRww;yIy>ws) lol,{^$[(SQc*79&й_ע KM%/q/ \bO=}z= K#?&YFҋdKQii(q߫C @z?D͝GhOv^+;eGb2| |KY&F{.{y$Hp{>+,wcq(k6nKCyE^C.hT,Z؛jejZk/63IHgtF$b# #JXPDz>N3dDhfW꺯E|vo-Ý`l6,0C+/ROBx9w=AX DѬ f@ ALWO!tBCu#Z Ձb9hmȃ4@W'v2@Fv0v{]]=l ^@y bȦB6 Pe1ZRLp0{ M16@xF_u7U2ukʛ%!_![UxH(/m'8۟DF )SWV`,i@j &81p<^yjP8 QqT**"{oV& OHBHR@*R@q^ \(({-V.9ܷwIX E,we 0_(K3o^ܾm@;8|= >j?GXaUx}֧}2mm6:8B f(Ofi"f=s Co@PK޷v9f .vX@H~)Y_kƯ5_œ 8Ü<=t1z,:1zADLG?aewbg :۲"o轖?ۀpN~`A@aȄ)t c<8:H 匄hc^V -gaӈaV3ӉBQoc=!vHy/8- = pe'((I E : yV #&/0 !qSm84k "7V3[! s)N|>DSHLF퍒D)1Z~ȿſwȯ(>k!j:`X XVa7wlT> GF ϻC%˓~%2 b:IxtCx-l6F#g/S>(uZfi r~ںkVnZ{7?7^ë5gnxxJ)?`W5۲CkמXy[W_KQNmLPc> _Cg4HF^ ';!@*J A:=Q-JhW&<>^AQ!Xm,sHٲ;W.i͟3~Usx~Uo;>O8D4UTf/rҳs2RT)BF& Ka/Oߞ"ACuBBC zJCږܹ|x*/-h3ѲruCpR|T(*`+lDd T"*4%촚Vbfo,QڣM-283#o^;~__=k&7y|Rp]Y(.#u8Y!3%Uɑ*4YJTRU%dYs1IvWGvk =0` m ۾|WW xںKVl=/n{TYV.“sNQb3JD [B(y AQSpyZl~S6׫ Yt$__s|>|agX|ymW[\[Kw5ufq@\㾁,JMKB&7II@EEZ`t ETHG?R(2 RȢ(xzy~^eKҍ뎭ر} 67l?`,o8t߆C1zck(X3M #8tMC85NCWF]Z~%ҽ[TxI)ȫҐcǮL;|jiF|i.Cl}ɏOdJѕۭ=.YGX㿃S?l>2=97 ݯ_o1Z4 k"u8wo )ϼ1_'T.lHVݩض:o;Uy$S]y6Cu~BVuy[U2H7NGNۡ*;t0?]l˚|o &mFh\t W55K6jVo&lLDJW֝٠MS?[y&:Ƣ"|y.<4;?󉀹X$%6*L{2AB4,NU[*i ޸{5 ET,}XR kn*k kMG-zx [U6UݳCeƠvڙ3^oy Z7uT+lU/[K//LKv$`cKKګb%6޴mȵAOsj{yd:r'euZ:R=O%EcQԥ1 L&~Fc䇬|=D47m-sƚBzKoC?M1~Ӏ| {% , 2ٚ(K&)"oHNq,*GT}IW $C _LTCš]Z"TF)#,0wj*w^^&/Dl10`@.e% IX|/ B-BF9Bt7l~q#a} 8MNg'̝/'aLGR/s!؞!2#Ͳ}>AhO+B>!0jd2>&O 9K sW, @`O, `:`A $;::IwPZ.42l0zNDLu sakһy^ t ! W`3A  F@0n3!n dңJ#Kѕa F~VBN!ހCSX2, Jc0 :ۋqA@$ mPBh&h% vV ߔqE۴ ༖s z,. 1"oWW\1)A $I`ev@U.!}A *-mA~,WfQ~( Qt9 wAz:Ȩ0e HOUw ,Z[H _"O-eՐՠizA:^QT!Uۀ3\A̘JzwгNjy$uRǓ L 7j-!tZ?TU]>OUOP)bPl3&yN? bB|7!FJ}QĒ Ye|`%_dUNV^~W!yд+4YTe7bPsv~.<" c U~U.੆.,_xVQdx<'QN_wT-ѭ]/o5nq7 (:Πu ;ք0`5w%Yҗ[2Nǽ"ǽ$^'M-TkN8g(PH ܥr+ΆU#7⛑:!2N;cGE~ M7 eސ 7,)}(vC6)r$ ?S5XN,g]"ԳmY1I}m㞦kL8l/z&$zÛbB&C78H~"eDV.y>r)R6]s˂IAUhg*Oz#z@^S/e{ ?ZwOslx:>{Ǣ3n$Ux)%mLҊKZ&ƠĞtK|!M~-J~-`&x@"Xӂk?~|yΞe-WΎrM(r_D>ϰdLfg .MBY-h=C+؏ѓi%l@] EKݡ"x>ԯvO v-~urvܞLRdW:xFaم"q-E8 +XrmJX1o+=P*qYAB.ҥ* FENx)>x-?bE nWޞIOlX̚\,CmBLQ,) *T/U TDYXef>VOf I> |5˪ ׻=mwlǂqcCΙZL& JP1j\Jm&Q >Ջ[tY:N+jŏ4#FABqisa֗.ty[qF׉ʭ-~LUtͷ*rsTOtZNed' JYA!6`1C~6&{I|} sa v~}k穪5Nk6wΥuW{ӁƆM1KG 6:CU9i1L2dM'Ds`0&Z{~Z`|h48^ Tvp vvҶ/5lÉkC!S ƒ3y*r4+@/0g Od%5k 4 ySڄ)L fx8O6ܩZP۳ʩg낆K+=[P]s1HQYjZNWU̸ wʦU6*b+1ϰXۓ \̠j?YDnwt\rnW9_Is{ö黢e'rO*?)مhK=d@5mnE7J[n_I^ɢk_:C\0r tq4ѵ>LJgnR % !qnBrlDu ""^DO';:u;A<pY:huU7<[+q|g`бW~@F#& QH0q9<)P®t]N:t%1t3K3Cd1c\<@O3(t֩ 'w~Gw}>Gua?؊1 $Ե5Bl߽w޴]I*JpL7`)Àp1Ff34$ #@(FK,?`7ۙ3,|H5*$jM=xjshW,Q7nf2M7-ʦ_VÁlowp;B!YB_!dcΆqdk}o׶OZў-3l -\hխfRMz=r~_KuP7*Nƛ8Dl N^&`-!ԏ![lX١e1$kUL(>##DE``>\ mPp˸әNЙZ*s[M>B.Wr!6![c?S| "´T n &rKN8%$hS`IG^JJSf`ar V&Ec}R$%FbWϰ=XCȞ:Bճo$d3B>#c+0n|||4??h"zzfF&#!*̄8&hb"a+0v` ֪Ho=&!;lOgOl&tu0c>c?ixXr0$Pƒ@u?̡~p0^ALJ8 ( Цg#-BzIiJ~uDSKd^#^ 1x/E#>0X@0$O7ea<HPY +dO!c/idluJFMaa#ދ @ h6/*aq Kh4H-\R-F_u2 8:N #jXtI$iO^#W4(o ?2Ph3VBiΣ )Cլ ;1|,dt#+kꔁCެ `3XP90ba'Cgq9#T#]~']]>>W^O*]ʛ=E'"PuTE   stl FN% K1dS̀rWD׭XRlҾQ~}th^_ v5Ui5+뺘:I }=82N Sa kv02"P 5J̶{LN据LJCfMUЬۡV骦tWܬy`5<;&r# Y@0LTd!?P6Z!,Q&uyŭ{a\`zf\fybW#6S}{#i/Y5;[o-VZ6j>_h>%}1/n *S-Dt/Ž,ץ7٤O 4mswmͶdmVg;hݰ__گ:kr:CswZ6GA$̍OfL]߿ڹjYN|2PR/5ʭt:]wq^ulr^鼜cnRż\ 6iWAkXPQUWOEvdi;2qr̀UgU-wҵenOEss.ɵkKYv]S' ?/]|EqUaOɡ{񟈊1X?smG3~YiJ[\}RE OV GWQoCG*8P\[boɛ9K*#9`YS|7Lxt{8`nj#tA.ZK !3̘ 3F342.CY\JnIWNw<J-v={|~o݌k}a+8PƱ^ %᧔̔r;JRO'˩ NjC M2NS<եJ}K:!Z(gˊƚwx^jqՔ7Gùúm4zJ3MmHi46Qʨ&2F%yYA~Q^30')3TAenBOb#RSrsJ;{2C;.CD6NLjJ}Ffz Ǭ *RV9UFmbRYREv >^$_Ez:Q PUXt*2yiYqg0>OI,z*Kb^"z'OD x,O+VE`]HF x$2T_Xmu{W8xPl-ro( kI2VfferB0!3O1[9~>90`Y.<\䩂V#@MjeP fJsL)mVJc uʼn(fXlDbU 2Y& ="g;`-YrUA} _7Tٺ0`7,W]t>[k,[]1'NEi|-etn-+"T^(w07U{*H9+s  >K|%(W puƅ5M^;TT[C..%JSRy )l!)?()E x0`Np?W7JZث4h La7JNUmP48ȕQG$,N=Adlj cŅaM@,'GKĢ~lj(EK V}+`ZwZaU0m;m嶱פ-Fv:MH';^WTasP]FbRZk*"Ҁ' l{bJ7=~: [tynr{B2]щ Idrx[zzh7=8-]N hL;q;5c>5m ^< 0څm?lv\YQ3uҫ .{]$f QB Ia1}}TRP_6)Ot,21`h@8#xGU `B 0p,@yۖo9onx9'xŌD]F<4MFFep0k7B}fC|FC~Pe^0]eЂep۟?A}<<ԇGG{ײ:Kvۑ4y6 Pa"&wp#dd){J=}qxz1Ob= \h ǃ:ȝ3g͛$>uN|j:?;4k.spczdz6WC.->wv]E:kXz.apb ^e.m"/M\0^kd>k%7{7>N߿ tv}]e2bGߪksx-[Q%}\ P: x B2>iawQM6ܵqvO;>9Y|~gok/v_ímYleg=UZX&s cn.V`P89 ` @{Ñ>Ӊ@k}_dd̶ۜ=7A.VcCi"D$3nۍQFtj*~ł("-EMr$@Zh IĄQDQdP]`È ϮOT:Î>( ~}>?WlBʻR܂9^!Hjb0*llaXꌁ/W?6ݽs,t;ĸzgXHpPbo";Rߊ w?X/*ZaTXۡ04ܝ=a`>G` N6h @k?f<"~nb@4x_)2o#nHp5(գ^r#(H@yK}Ǿa;_?H2xM|7@LT9~ , ˨_L=$Ȁ]E~& 2GR/Pss]: oW`g;Xb`= |PWhUa@ۅҪQz-u~ ;2l Y~v7D{8g6Y@2xt6."BY4x28IЁed,e|gnb Ӈ郜)Z?{{HIt (؟<}$:m3B}@B@<}c rx쯼rV WE+'0sIFwF_N}GQ;}P'F4@2_ 28RN " d] sHcA)>a'0-,u s?*vp y\~r6.󕤍&d>pGyOC@8<b{i>@!B m>p7lTx' nCp%82$zLtРNj{J8SNy`wDh3E/F>(>D>><$/ޓ]ݑ5nE݌(6DCe3ח8ځ` 5gꨁ4@'t fUK}ەqVyq!A"ɝ赒GKnl6ތވ^=+mk^{(m $ 7q>"OAvJ#"y ݭ!z(gmO.ul.=C4-}5'B7W+Mˊ]]K,;u:=>;DpD=fbl@4LnVj gd|Ck^,Zu!27rYY3S*y}.ɤIuc:#gCɟKP}~]_oX5lAY5u Nv`51JcZ7@o@-o5H<ή"_ϭ)YRݝcTmIl\42l23V* {eڌu%縮^c`XC%M czJ2{F"Ҽ4;bY?~Y#g(TY޶XL-3\n*5g*M;טdNf2].4=)]9ԓ3('aȷ-t"mi︆Jٍe>qJюȪiK?/1/ )\a0[6m\C.`0fȥ%各"Jn$9{vkHK;>~yίuޜŋϚ7wyZo0=_V.ϓU6R+W.˳e2Ҧ2e3ٲ/dsT[S/Dm2-Frn6pՆ霩ZS-v8T8JXU,/1fWNjr^<-GQ-ϨVg(';CkvY,㹜Ș õL[SfJ`R-F}O 7]|X]y[xuSH}[Cwmޙ=)[P( TF6E*^1S(cȉW<ޖ=59FkhbւZk`A n6/V6l㢞&?fK}`mKeUϞqaY|DNqRBZQjZb~"./OWw07jg*reD9yOT_eͅA}WXn7Sam8΄՚mzm>QT~p׮Qܪ0[Kҳ"U9[Kaŵ9a% i@[%2ED|*5[)jHq`s! t‰nŽ.e͝ƵBNacIcgSD@v}Lhjm|L|urrDeZtRDZY!<.업T\5*bG0&`b/up'W'+*t :$n9G|eQ№xi,YҠL n(I n<]x$I؟ts[Pda&AT*QT*i.n2*;MΓSH׃3 e}F)dк㒍I[6 눏 iO jW}۾;VQUq:*zĦ·H}R<,#38p``t3[ Ctk_p-:a8+tHrmHDMYa"*4Uؿo<ȯX!DY2׿ 7fG!GHBkFPvR躃+5㪧YKBo=C}"C ~C +|}{|W|*L{? :zdC=I!&ߢQm(Qc<1G&1x$Ix;vvk$wם4{w;qw?u!CWjnR g O졙z GC3-h|oGω(Gd 'KVuw%~T3r#NLazNYeT[7sz]LiΚzKǙ.Ë,wX/ۿ|:5rtz_NwD$=QW_QBfil5r^M\^;ҝ޸0xٿ7{lf>Ĵ`>йhV;L9L8n#\$9.&_qG/f"H=uH uݑalrWڡ 5梛 -0ИWcJ&SX`Dd`y r̯(jjm%KQo#H7B!ֈkLh (20-˗c.Ks#/Lp?d_x 5,؈As RPCK-q2s\@ MW!Sњd:-AWE譫ej(]JoSy0D, D M@Cf"t&LdULd dgE-tO︟Lpf>Z`fAEK D1r]ih@j9Zb9uDZ!͐{ܳL 3Xb|1?K wkd΅tC`QgFEJ3 mL&)lVWD>Ѧ_=-t#tqR26͆i3vlvgEn]uq*su;#{t }ܯ?ޏ>> _P-Qms?t;qe xcV8[d (?/g"93Wⷠ^ 3{P,N'SGCRǃ!!Ҥ q.  @YBm~] 06L:Nǐ\4W\Q~L0AdHd-~Tp_QDD ϣ$_G%(}'o?c (w/~ `9.\W?m>p068(O,߿)h5fcRv`nTab0iSoQޤ [6> uxЋC Tf ـH9W,5 AY1rd AG0g\"f& eޤCh25.zW>\/w9b|O y}|7u'©8@삝$c Abk]ī:iۂWJ2$;$Ys= s 5&Yf+4tytyt5q5ɚ:X; DKA{I6}7}˼V#jXUR"#%ekN]lC1vUQv]t'%'N;0${r;}ʝ~ͼ".V@Sg^oq2{0nXqMCqp]c|%313p~c{b!2Z[nZ+v?O+I#x(g4@܅ [l{1j9N&s|-彛ݥb%RAQ}p3EWXGX(cKY/<̬e jì]7E3DU vB X0@2Г\[^Vŕ< ۢOo!f(1{eJF$ ֱZq)gx7wxJ|[)╋J/ay;_ot@dee[CorA#VНP_墐ltؚЪm؛.4dy*Zū˥%2iTڐd&}/=T,(,JG[@%-̇dRoY@A;j)T1ɡcn_o؜DɐU*etAUX,O. CH5uTzS ^DvYMc/eՙFT}iffG !1j.P(1 DdFAe5,g>*#xܺu{s&HY-kURܼ=yekխ^wcU\Ì_: f~FϠ!9Jj2D~QW}=!_sToE)q)+ 2Ss22b)8]pcEtA[JT~oJĮ;GSuLЛC?prTVAYDITz_VfgAYϻm9E9(:^y:ii]:6?fiHxMzXhuvfk 46&8jPPBtyK2 Dvqs5ߑz~~u[m0'皻IUo+Z8uX}OH}_P:} lP ho_.YOPr`[n͂Y}GێFiiI;mcrac*2W[kT~66ti*vi>\jeiRxޜT3FzW KzhOR<I=xt^G G/DmbUDdU:@ۛ>)a 3Cnzv :C/cdK*Ksӫ$G{{d*^dd({md_Al~D? x@h7 Y:2]Yov$p:fx=zd;j&JG/InJ?Ilj_#ف;] @@T@9'L '\D1%5Smhiw%,PK38p)XBc61fa5u9G$$3'3A};6( SЂbVCt|}3 '$"l rtZG6L(Yհ%$FB: tWѐ_GCy h~:-zB MGDh:lfCB\ y3Ș(RQA`"6 SX(bpa ={(:H('T2Т1->K_OZޤOJƤtlPK["CwYR@KK&Zٳʝ@.J(YA6J6rӒ])ikB5!+e);zoU9f7c1Km?1dAkkd8b:JtQNCaB~\gcL0|qAqˠ *0HDICv$ {N%$ @T\^ю9vuwnj"ppPawE]Жqf I15rbEJ2ݚ.Vg զ|E`V&AaK_}J"2FTQg.x N +Z%̫(za{>qe=VkFUdH %Jz.cJ1r5bRKj%4]sIy"MӾi%kEiLPptǹCZ\0TxtZBQH__V+ 2\C2ט*H͒ufyT)Rt _P)ԺWrgi" *n`FA1 ~g˽`j[Ž2ҷ,ni\bM92qL0ȓ9JXm*Y%sJRB+d)LPp'Sw aJ߯v}v[ $T11%^x^0&;_J2VJFNˌFؘBS%0(ƳH; [ȿ䉙 f*Dm 0~)8ҸPv~յU5rL+3Tj4O'2ɬ*١ei)<.a_JXI +G|5r?T:Qhvvghcm1jQlr"+S!ϲW̱$lKeiJbYLiA6aK&ip&<[3\ 3h`:`s֭#}KK̇(Gm JQ/! tMfdjL[asN6̤n1h5 J&jED3y {2;; @[v7`Ttb\K:>p!icvʉ,ptFsQN;$QD@lzCo/9- |`+tnjPzB۱Q4o>?B<\к2>wU$Z\PUV:2Yt;+2)9!IEi kBl٪UE I=܍P BN!4B*Zexpx_U#"Bм)(7rݥPF#9eo6-ؖiTt6ΤZߧ#-G-"֊L°RAhG'iNT~wokރ}\6B[3ßE ] dH vs=]'kmo>W*GV=!B+ o s[J@52zx+8a W?'FH4_=j#|_3yұy\f|1#~Mo`U|ߎg <% 7=PG8L w ,`js|+@.\ Hp! 9쩐B7^vy"3ϸ|Zp ͸!Y: ASBFzˁŒ&A恒-̸MwqqszwL 4@Z 1 2+ aȭ\~u;q.Х+9o+q&gTfC cyIm@A_  0,&G" ^!f  H6 Ncyc>Gy}y3ewPqӯxU pzcruˁj10FT) Τw>~1 F#U?_Đ1w;Mk.^hZyO4ND>9ĠVP@%(Y:2%}y](~B iW /[)Ao\Ot?!z]$a\x?AŔ~ԇmAn|8 oP;!w!-_CE Ivϔv8VpG 3<F:fUaC )y AIiYREZMk6ڤ]a-fxI\xvxzz9Hp[8R }S3Hp7 7sf ~Η2\ϧ<ոo21ȢHmOLoI00兌rSD>^Y+2JrIqT \N" _ >ByƟrIp u9c {[+HQZFe*xFq"JQS1)YnV,T1.V[[l+Q?BB!yJr phLy;C̋t[2#-钀M"ZaNF٥*#XeFUg\j0.O5UgPޏ73~TBE Y@7_JXQ E[{[s=qjʠeP &L;ae?XAYw;\'5H% F>2Ӳ:MH1M8E#VkFIYJgR\^Ҽ$iB9wȻMwvp =aZ*wԗrTa Ĕ tAeƧfEt2/"RR|f?'jF궀 ^j[^Q*,re4QՊ P,jebE$"а">ElBh*t,oWo O@O;X}OR76Dl5ձ<򪄾& US*QqE /…BX- ;p~Q| p~3~<7xekD 0۶:;@KvVkiK΂&F옶^LI'T)qs*3eMFgǙLq\e.׼[5]*#^q:*>@7vs߂ݠM)Fc'`ݧkTȉRISy lnibqbb؍HV㣈#FE)z PSAO4!pJ~(8s[t])=q݂SAWbH\:<֢g- βtZiѝB-(ˣ`fjDЈ֗4[v%"͟EeE E+FB]?ig8mT|K1~[2;֤heͧ0@% :i$GXaX?f? }J}o=,̣Ϡ;T!0LnK!풷c$e}Dx1v/g^>>6~0mCc^AχG_;َz@{G78 P6= ]IsA1wN6F8o6l3{9> ΨCfQgKRg4{aW썝#`]Wmut)4>4ͮB ft(n!\\N-c/yZ @_.1/qQDo XN\ojߊŕ2wegF/7[aх箶@r?sͮCn$/!A併@?r Xs&Rj28iS(!@:H0Aİ%V[\=]*(ذV֊um 6EA of?^{>g/z8L0MP9Q_9W([.B1 墐Ԥ_7`|9^\k3G:0qkQY@]MP΍GH ұ9lj$z+=}y\gos%VB߈ J ܯCȷ!M#B @ )K]5~46l b_Z)=@y@@H0!Uh"<@?r-C 4P.O_r3s3O.5i%ژnVzHA.' l b&3^|gp1dz/-gA>-(½'!Kt] ;D7vQ5*'>[w";$Q t_ }d*,( w 8 !!=ټqŜOVrdN&CnTբ8F5+Q{e%٨#+G;]L#p^:7Pྒྷ# J ,Xp /#EvN?\r[T˹ͪ՜;I]4w1oJ7nG3+tC{UV\sX,B|+bFF<ɵ"}QG%αEd/D=cF5NGu)ʢ@y2N>ގ?-F~ tIi_.g$3Fv#v"yK_D^>p1KqθYqָMqڸ[┱LyxUy|PFp=`> C ɁDEN4U/xQU !;&#[R\sysq]Mk|թN/STV1JM;TL\7.1S\ԣ)2g A88C-"T$C#Н@hɅO'p=i~8ܦ-kSle+,Z~mX}7ײ7RRady?b_oa_#arhKEfB:{cit}Oe$?ZlK*JNoOouuVV뼀[K7Y37Z7f[ Zg=z9xuRuHfRcʤO+ tE("*'wkL"ХЙ^ǦrL(-?eh6?=Ր66ps ٶ١Yakm22mYWr ϰ/O)X bIJC_R /H "T;!t;?MNРC bLNwʛ8Ty\ou&N.bș+Fe-ZdҴ2 kADA-X@AY$}A@"@$,ְM,BTj\ѱjS;L]PxB/ۙ*93ܿ}y}{Ň(QJOԉԊ_E׊!f%ff6c *o𝭲b8Q8*n0޹?+O%K mːGP%%1MIcFZ'Hi$'hU q813M-yK-,7MOb/ŮQj p|-p[}1m%mwЧ#7%5;-IU[+UҶIU:ze} %b S񐩔07to$.fp՘Az\G֐T.ث..eY&mo͈gS[RY XVRɚJY'PQ <Nlu##{̕,}` |?G50T ꭎ`MO;ҶLZ_%'H NiOmk \6P9Xv>vjގHh> l.+8'{=h췅7'Y+.c8>I7ut0 +gt;Ct H0Cwq=]UPѺ^S;mfN#׏o |phܡH۬%iL|}b?>+ A8M?K_XM/%48s?qC%G /72G S쒎9 8CՐk(1Ԯ1{F[I1uλEnFkġÇޮ -fs76 c;u c<,`%lȅb4VD.0V[{Cn0u 1^s9!xtfiЩ7NO}gGoI'cy@yE2pLN2ɟL3XE(6xP>Ĕ8x<}<( f]q6O x>xn_,e/\/V/| 뉅/ XL g@x/,^%{ cM&p A"[?@cNIhΆs \JޮAB*[ .tOs=p았K)@w ,`;1$35Yx ~H>Xz9m~sTjt>LTf5ѨIt W%DJEBTz7"bk/"dx\^g~~3<7> gJQjGG/.&)$#GC +$l">Vl']0 0=wo,B? x "GMWO\C 0 בXE (2%('x;؋s#8uᅧC|yO'"C iCl[LE"DZ=h39?(5w7dwxMVd QGdC1}z؈A_yrwdjGs p"s_.r>X,^E3ͥ<l J)O6`_AH5#lvx  w̟,(-Ѻ-'KDY Yr;(Gq0g:o1zE)'VhYXPSSlWQ~wmgm/ݶw+vϨ0ȚCb&9sY݂k͑fW[B;zdR]ub]}"ݱ ]gB!pn_kJ=H=ͥ@;͕6Ϗ,O &(HT5kt ҕ3SӃ3eYp1i!dd=a_Gὀ$qIO;*3ÿ m( R3R T$TX@AA LXXk\hƬbI,ѻgx̽ywO~}<\^ c-{ cמZ3ǶM}urY3-VeDd,sZ6=yiwbjj”))sR(f4(RZ)1)71ɃA1ɯc?& }kpȗuRl/4CUbZINA^њб#rbR2&\5obtyl*ELZQptfETnA靁"""# #%p-,#iO؇KPUbR+LQ),[`U8cyv_=$e9AY_go >Y>!/}B2 F*kp.w;Mw\TV裴~+&KJ̓gY/s]85 3"wX~Oh~!_7}F!'=+׾3h0Bb >Fg|dľJce+]VTyk/dhcق +blq /OZmFY{p:7EWEYy 砲+N%CE\nf}by}=yϯ`U12wXagɒOiRFm%&DpB Wf:) ʝvʃ6U'U]4d׆Ov\a Ζ'os?[;k:}z,i=WyZqzv3.2n~+Iߺ>u;,k=fU5kg/̧Ud9i(݇w}<]^K~`Q 6c^D7;#hɛf7Fik՘d6qgchQM<5^4tkԽ]|4,ѓ̿-zMf{ѭlvk;Imjmm p]8}օmK躴˦mqnۧvD˱o4'<ղmt95FPq@oF+kp; Ojc4:0Qܡ:vDH:㥓;I;WuvnTԹKպEeb_T&tvKƟ|by⍪wj>Dn欤.=";j?o 0 .LM)1Ply1\<ŢDf]ݵ ]M0:î08 `phoo6I߰qЛ$bKU`܏bR=;Vu;A{:$dB*=50ɞS?7s0tc+N;OB- "H!y`Qߚ@ <A7G\8яY< ѝEw2|SoO]$5gĜwaE 07#Z8߫XT8yGk7`` ҫG1 ~B7KWyOމ1"ɚ|aQXLaJ 7@fX-0Y*SM@Xe"9QJ./ф! x3x,] )|JoA7cl UQacX"L{]LoUu;]c'8~+O=~Ex3QڂĈ111Le !+~Ţ?Bko!no+];M>[046x e K5}MALCО NꂪI8$QL&z*I>~`PRI'/=7g׸/?INknWp<,@}mO$σ'f6OܔݵE྇ ܣׁVpdz w 1p¼%e;~.mAp";$ak)[ <yiȗ<L% o7`3rр3Ns+rه1w#X#,ku 9Ǻ`3^9~hs/Iٸ?P3 F$SSGDI$͇)I´B2lx5iH涐rgȧS!I8y7cww(8%x/)c<d/]x8 _N$WP{p/ld^ $ ?,ts8%,r8)p8!qnr8&lu8"RECAQWKEO ~s#zO#ė|@?%OH ؂hDD؝)щK'ӜuNKM1q-uTlS?oKC{%L.|Kry@ĥOC+]G ėPI,O̟ per0OJ#.#ҜR=mHjVvKi&NitktutԭW:M:#Eأ[ ?0p(LUѤpbmOAYNY._VH!+̞d=Vϭ-e^ݲaNٴwOgM!#3!>P f`=فt0DFCSdzoҫ'IEY^%˭~mNy|JJ|*Q> [`uW,SބX'6 "pɃQKw(cW%һ T[JN@ lFKhemjD[Эu =F'U%V%zeBbU3+PY3y"_V)嶠tUZl-eF18έ 5lL *)99j:/WDJ)*M۸f+JJNP Q09ߑhyPs ([W@UWLkUHiEe ^F4 8iWn+zQ<*YWEratd@V = ^e>,@?gkaH_5|-zoP_""Hk(5uxmeڤ`(CRKxF X`>~qtz)^Wj|ȕ‹-z ?W8= @7}bL([K$N8WuC.% c%UkBכ8s Wjn wƚ3Or֙1?dK*qĦW! w]Wy #dg;k m0P:dmZGukEڜԔ f2,yXK {cieJ, e$Hlee<3 9* m&jnzy(r((}八fbZwg_?><ߊiGz$~UٽJw kPϚ!sb%@&dˁG~/f&eĨ'2ڎ]9C]_Ok7/;pi~C}ӠEI5I~]Fa+K[_E]:5XU& dQҁlfaߙžksCJr"1^[;۫ٯ 垜5+)k1kWB,jG|V{B}3]f^v]}Ő-fU{9{|^j-[d(5}z`B{"{.ESQ4(^~0Y\Cbv+xǩo4؂TGCAZݢ  vGE"h>,áKY*r̻ZXy|\L޳T#Y0Ih)k1FGj#way6&Ēmus[=6?%5]f[BnNΖ4m#{R e0r0i|*GDU H!'&KäRkd&Z? Ekk,x[&xVނgcׯbμE\\<$][n >iWxg} <0 Ґнq6M5lmh! 3Vry%3/`YU}c0[4G)6M\n7fd^|AKe6EE\AqK/̵̼9{}098 f+@{.hUCȇ@(5׆·u^m<۸nGCqඦ\d'{3Of1<(oέ_TWjn-zh#;ɽ|Ax)60* N%{*c̉=.0eؒ)$RMHݥ~ɲzOg)@|ʺRUaFZA`` ~lY XFJA&99,E>Y,K)-g;&qsN.bΣgQÙ8Lg8k'_"*QbV}U6cA'D00WqYLE84㬴_IRFj=T82㔪'p\>K8bێF)WP;FqUKM]iM 4uӎpiN8-q8꜉#ι8RFw݉:8v 5nюjnNU%ʼn|/AO 6מ='}F P` \,2TU A 9\K,?=T_)A[.^6_\EsPpgp(xX{Xg_Ž!{B!ZCU]5RyXTQf,aU9^֢~C)1(L)6]R!*!'n4i t&zj]1Wc,[g,622 jaX;!b_@ !B dMl QO"8nxqicם:v4Ӥ[bil̸xF9wyrx-byF϶6|G8f1 q&KĜ"c$6}7}f~})1@>GuMX<&cUpLk7vU+>yq k $.A->TےVx$E!MRjl"[*~-z|ɒV},%!W <-\Ex&kTs5ԙn}/ m0rqQvLǑʆ84G,[Tɶ88"-P[ P,E$^ zCMԾ>Z1o9lZ m0ʴפtlo.oQhT Xy)U(RĊ&Ne]Gn ΐ.[N+NZY.{SZw?T9/6YkKyowpow`DNڷgg0 vlwQ5hISub!9BuSҦRxZjWmTVvFJ׬Ǭ"SVQKĶ]؃+G0sqd3wBw0t@GO;˵뀷*, "EڪZfik#iekzR4cB2Ws2PsYX88I4dM=>{p r^" @7HՃ_I/HSV]( \&@׍qn#Н9}@w/*QtnǓ9=~=Č, ヨ?pWQ/h X]DZv4U2Bx!aX^Y"-Q]<|D~# Ʊ];=^DQq$f) L4fY u`󠴑{5j@Pwj@G {r) P_]<螿X䕷P擽P嗵 43~CY4:cxғ='ϔٯY3){\zۈ 4>n]hXA}Ce7@faNs]vڿwO_zpe&ۤH1 Lnɦ5$s;'=t_Kʷq+^qـ~ԝǻ:nhXc(:Y f@68ilKCi!-UNS1cw,3,[[؅oݱԎ~oa8vy52*z=<58~y khkDYS!Һ­vt+i[ !Jj!hWco_(n} >y.4̮OCu|qu~v:םs9Nαai)ItoQ [clmfvw/|ޟ~9?Q&[85{9v=aӬu(@yDH n^&G1L#w!RU@ ^XgyIy/0`Fr>H+8t8Qlz!_)6/>mx񠷭u? W_ ^j$Jr-@r5Уq 2g*.l8B/D ^MAqSٗ 9T3wPpNO$8-)4|Z)8fV8ly8(~E)hT֡Au{UgQo}{7rP(`+ H'x\E g|%yeo폓&wQq82\gbk"m)ܖc{sQ{z&qMqu1⪰Iaa maIa)2uCux:GR ٬.lRWI {%ǥ꛲|yjAU V/<}gk oaw0qu~6EV!+ՌmLk7kȋ4 %tzm@N-~dQ֞WPfiQejVjJsw:_Ŝzl0l B[p4\oU>DQVn*SMQfU2jJU.W^h^nfEAOm?fLn]NxlW<:ߜ&lIP9[#E%޲A:E@u65vvvYv+Vۥ/gۧ;,ӗ:,W;.7;.֟qZ)Y)yS׺|MYcl Q饒qDM}9FͪḦa醱N ӜR K S ΋ . y.Ɇb$C<>D)9N'n u? ?wDTb(GXXe}f6$rbxIy)t9c,G^3ӍS|w㍏^*<6+ߜl[X xbML(sxoYTQS,F$sGy\S,SLSrnSپ S~{L-LT# &š-cX-Mn 9\(J\.haQ^3,#|Y[&MlgY8ђ h,h6x;Gc߹H2 3 l2 DAvG`aU6dWѸhmh&F5f['O㾆k{}9咟7N7XK\[#dP0'Mtse8)].m~<Ш"9ĬX9 Qb`/wʒfΔK˅i:W5E+JE2!Q#QBg q]~ @X |8r+1uC%h܂$tnȽ|}9vqDC{!Àш>F̡;2G]uQƒxDBxLxG#;܄w7fU\s*Ԁr/s0}@oG $w |6ecEˇ(\Ɣ?1g>sB^@6l 1Kw8<΢3IWy6qUq Nc+/` D3s}6܀loif3r> ~E?6Ib99zCO^;zԟ1>/ɿ-r#Yl6٘=uyDs= Lt50 & _dqR-ď(3 -x=0P.1ɺſn)}C4݌11+n.^"(z̠OI_ }U6:x ^zezF2m,#\㪮[40` :1X2YJ̈0|8:Sˡ j詧XKO==\\|}y\dDx꧴ h10}1/ķbLWȤOIO =܆05p{g=j/=\QIi! "@AAMY*PQPTKTL3-5Ki6u.Դ]LsfͶ{mjgne?>x<jL- sqa`d/Q>0dĜFaPW>fuQu>B|\q8hupw,8_ۀ@?7WfLԩD7Gfi 󘓳?1g`}NWkpc>O 8џ{KSa?GbzKS<ʏ p?Zp\dlX,s$9V8ñ*8Q G"` f"a:rDN~LN a) ?%% KM<;,w1+Ap/DIc1J8phY)L/\Y=Ly`2 u޸>=q{a4iwQoӷG-%">Y!I$&;U*Z,P.KB&޷ϡ-`LX bwJiߠTE$fZF*Ӻ$UNImC됴K{ۤ;7J[s ҅z@A-c?QOQըG :QD°-bPLٖBݚ%ˡo:dEJmi47Ehzd]z١Z!.B7:ͻė{kzAη?24v0%}YlFBAQ[!kC嵡EG[ǬVYN|XrCI]0_ȏ5r/q@8V!bp=q٩%À BܮjR"![Rԇ(,r)aUJWS^lc;=lrS)G(/Fؔ֬G֬9֬,n3N &sze5ADMyz]z:2:Grj"]]QvruuKMųhxŚ ^(߬7/P/P3@kRy(8ðGQeVs\h1ǑLI>u+ncéW8ԬVej6oQGcEg?*LrWyw(ywKkL"dslg#kAP"dwSj_E-^`*WJ%\϶ڄY֊Lkm- 3l#tۡ( ?zjjyO-~O-.q }>_{D^dJ1*8P^ % Dq״6* [*~ki~c+/ձ;21Õ"$ ʞE*r_q>,2lGq og k|:ֽMʯKJ5tպLw3mOssR\vԵ#qm`vuv [ftfo?]3Vr7I:< }fmN޹ |qkN$4'hRGuGE]q;p"*\Df'rknf7D (0(" eVڶ{ilw˲mMr{?y#Mٳ"Dޒ. gfKBӗ~ñrc՞oEU%ң1 Ԅhhl~qGȼ;oͻ'8+obkjL=]9!`1p}_ H]A_^ JY~=:xh* OKh4Pؤ1%aN3eo1QLV{0dF@j\ېl[JkRI%2<9]#y`wk~гs nJ|σ=c4s4fUiSfe={+ՓeJn$y6{7y=ExjS\e_W}+W/)-l\1eWL1^=sc*؋8ieDƲ Ws;|3+)f4tKCI񌈽- TB} *To|dM7S&ތf@0xCu鶯<]JOZ/-'zp7Ii;>-R)Bc E1h7e".{9p)vLhvЌ^Z΢/ˉw!^N~ȨgVr.g 9 . %!X4ĥ@'b$,~_7~U-H >'|_³YGJxs\q _nЛ-tQb}Ρ 6(ie.5yfp we_̹n1s1@D:J4^?h2g~˜2.e% J9sg?UOUdCW3q~#l>Y/t uBك=(> w.xR-N. .p TcmU˺v !;>DMu{zG7J1p;ci!lV\A maUc+%ҌVJ*%XK7!~4ہQAGXe60#*&''V)nalk->ϑ:Spҡkg'/~;6}™ g'qr8 ы09$ j`]z^=vQMmdkїe4A8[|EmJ WMK5mN2m1(0gn<ľ(k.^l^0;j.GyceeMr?9+eQ_ۈGhǿw;{ VͰr&*Fsy9Z|Z8l`LkǭyXW;XW9WV8 mf۲\QMw $#R-($IH@"p5\EejZZvkzyug[w?ekמk%{f${)8*_ɿzz,8[ }-jyBE E с,tQaԔ$zRUWZcZ_;lVzy>ސr7o@5WTG=n 1^;ʻ qm>/Ӱ@'PKukY4ь DE))ja? b|FAMУtb;5c^|\d|f5YУ-lRŻxwq8=hݨ:XV,c 7h\FX2gߧ7zt]8ߡu;:E7* MC ;+.ݚة^q:p~ W%8f|GI4Zeb\^no1TSZZ#ݖ@Tk`sUmѕj~EKilYQk5bOT*%XԠMtSR$$c$| ήmCQ7.0& Lj3DD3AȞGc|$$RbhB$ )(.%AL(24AOAav:&?s:{}ANlE<&R%!{.'$.񈽜H%MFd&hYp,Y^FsKDOagq! cK`>cМp&Anhb X"J}("0+|l"#:CzFpdu| à+EnP?ѳakgȇ)k " .&ʄ"D1/"Gx `80/'!]):paaS_W0?;Dy}:w=9<ל"*WUD9Ls( Qt1B!?faN%9ysz&[07!rc7.;BB8uY p "( ! '^ Zj6 usZݴ+:Ugk;i7{Y>*k|=|y}؟JL1}ɔ[dN=9XZu:O]rQK:+Ӏ,_edva_㓁9FDSTWдBmqJ#_>g%y?qE Wԟ"m-w8( }1J;FQ(>:YOʙW̙Sµx|CEs&?9 q]-l̺dyS!Q_Ιp<&Dgsk7w3ps}䔒 Y/XF ZKFa;x/.Er0}ܳwp-#{-'U!d.P74NoWSOf7?C8q;ƌc>~ccJ }/#mOQHF) C9u,a[/Czrx|pg_Sz cWEo,9Ym6Eḍ ȩaԓՌW}^lc 0/VvV6V6ҟ|Z~ra,02K +;9yܹ>!!gÈefFv#IX齂oGy}7O d{zpP>Q1蜁])\lcZ\҄-e,F:lcl7Ɏ`iv-t~R8?o\S%8(W/`#;=]~ }آ&U6JЫ*ScVk 5n^CǸaoas_Qny,[<^z$70~µ Oy|.85؇4Zr}:ViJ4`ʹ(%+Lc:htVaDVqXfA2Y2FO/==o}2 3Ψ~+%vUKLw1Lj<o'MX2xh̙({ wl)u4fҨVz5M!9r.L%**c~VaEynXmY=gDأҐRb=R&EB*Qt=@Pbit7u0nf#X &J-c.<>v:rΫIRr)Y)nXX́Z5\jt#TpkIkX' Bkeut[kpv͆=5`^K u١Z ,osƮj"ı8vr#:.$|r4z= ֳh<ӈKt]Bz 57}X9b0#vHuk'~~.:sr8 79߬h(ܞ' Bzh~qx4V6pn1o1ǼU+^k__{}~@7:>Efh~PTxŕ3"89xKZ 2Tws8OtRtخLT/Z3ܒ`ej{jqA3XȪ#_kb-W_RUO}gqV:豎B|Su&^x{8qp&Ȅa1 F.qLqYg5u]ئFbSj z.up]E|ޞ3^ 0`x#`Icq%FCGzZP-]Qkgz*=DͪF2-wRpȱIJBxCጆ3<F՞ 'NY/ N뿡Mzu ~qքv|7g[sUʐ8['i]P N+,C%aT6Sie" ܥZEK#vkIZmCqu^Q>m`%0 # $@ ]#cK`lu2m:'Iڦm:dLvI;iڸnijy ߽O߽74̻OyY؝F뿉s+/" %vҪRE+Or8hA-(S#1:\>:g{&ivCkz nC7?nw'X0Z)_(b(lL6ʊF ,='FOqx#)3K)K We,:Nc'u.sEaj̝OfQqrN\4[^,oH>R3+ߔi8Bj!1IJX$KhОKv5xwfl~[jְ$dmm=f۰,`kdޚUYSe溼{rr_WrwuV/cQg 2!ܟBl8 .uYW´m*~ifglyM8q IZd\K :p;X㿬ÞeoFKCr-zǠtågu4QZ=e4X^Cn6zw+[T {|ݽiXQVX^RToПXK?/܋߃ucq1 "8½_Fm\ T0~9o4juz۽aPXjߘW}'Y"[{Q^#34ݕd ,{k``y` 8.\ǂDZ;'oup Z5(rS0& +CrcZU.H+B/HCߑ?wĺRmL_Yp΃sh>@P I `NBqpے jKd;JHQytI#/ihu7%;:9Q%25&DeI{RQv~<ǰ9p:F `}}DI"lE;&%cT2V@{STғ:e"UA)姂LS^v&(7αM&yv ~B9S2ᷰ!{< 9FLDE3<ʟeIEyiJRnK[hgv}=Fl:AI$=EK$yӷ7KO|H$O hq; vؑaNX iYxCD;f,$53e $Xq7B L~t0 ``#Vr=}-`gP9"a""X\;2Cx(QOq澂Mg)$wI\9,6-,FPߡ) 0< l/U^&uh"9 k<0a{J !uı8hֱlc@r73xe|1 hSzu7Zv3\5Wn{C6GG?f?{]P(`D4}R}Lj=ݭwLokdN S_)xf^!A/o^WQO1/3?Uv1:T:֣wRk'׏pCm,qMM凓 gBb(sJ85TA=&8mpVa^A>afr_*+qq?kyL!pG僕m0iP5kiVԠvR4ky[jR!XݖKj%ϵvUkzuHa\cv6 &[6؝t$jMdS>0_+i;6pZVk٠EjԬvWjܥE!UB^т!vW;ԧFq}pptm[x7r 2Hk~~:FaZ>|ZlxZFy,5%#0RC>t.ׂkU3rGRUc*."=ͻ_{ Yǣzi?vpoAz׎Q65\"2کj !G^<;iuYcCd(- ʫTUGT5MQ"ܨ2Cy|CYBCit$P8;f;bN b.gżmiV}avim&u梿],?@uP8oUөJga3PL79g88;v(Td*[iќ? 'ZŽe96h/$~u&r<$JǗZMUpm(uJ\dSkЕc.pg,,3Ֆ܄AS$k3m8j x=6kGl5~`g4Z>@ur " h7dEeE妨t jL66&4I1jk$Dicl{㼊˿9}B˓3+))F-hu"5gi`nM~:4:w5k})lgO3۳LcE8{w}w}hs^N{JhNiZw3MQK ^52,I!ʆ&Y,欐g9H4)3JJpL2uL3q1:z8zrd(7tFd2Ddhx]a+~;ay s̵Z 7cȖ8c4ڙhE9gisF8m wPө2 u)ԹSC($,+_Sp Y?%+d=4fCa[9ғX$'B)ȤHWF*8 sMTkRJr*@W]+nCE/˧--s=p=0\)哳v*Ey6 {4Xú,B+| p4/dg=O>%vgfn|ffy-4Ħc Ȓ Fnj] w%Nm=HK]Rᆭ¡QÅ_ReSˡR&5Y0; q4=mjj] zgN {69'qk0b06ͼao}b<\<]M C6݇^`a#y&ɍ_f%P"ZGKGa[yi &iD ~tB<ˏ!y# `GYG1zrd`GK3 f KgB~"a4Ġ gfuz%:.ӓn&n]:عn 9;)goژQa1}l~(x{*1Lvqw{ӣ};q_CF&LgZ'*ҧ*чT7qOQ] 6]eüK~zE_;_up/AUW Ȥ*X_hh0R-E|ܚ ZFJ"WؠprWXG7n Wv &NP'?GoO;`5@(c>xZǼtPJ"~+_M[6BBк@?Jϲu.:?@AMQPf šK0RYsقw%ˈ_ɖ;غt {Z29zw~}ۗ{tE?TDKpf™O|+ݵ?T.^Rk`T6Wx'?RG=:vExr  +0f!mķsTd?S0JaT¨QOmګV:h=Me^k35ӟa^ OR /\baM3/!20r9 `x#ଅQB%GYi#QANn=B=w~H+BNicg&a$g`,Is)Sc=ycomdXZ ovD޿uYO^p0(xa%I8,lr@\ kp*UtΪ*'2E_ou9cv/kyGM`j0iq꽦iy/P)EզTUkO%o*|kTjsg/͝*2wi߇*.2 *JeͿM۸v<?TuT3p.`*jM"U <ȮҠLZE*\U* ޢf9-g9\Kr,ʶ|/ W!szǴ^ /WUサ{ӆ+ͻvw&Gwd7MdC6&ImhhB)BbN BA?# 8((2< u?=s~{4©\ږLVM^ѦR9I4hF+NJq~UC4|Rq4@6`Xtn_lu֖bMTjSOzm,\6viOECJkxZx>Q&`}+]U'Uy#U!,Q76q|>6K_җ\L[[I_ W\a F3F_|)ft1*'fjnk-}hk-6ܻD7}~XQD7VUjkUUfOU]ivUö-Z3ck>`_voqho)/#¼ [~x7ڎ{~mdjгBz]f'hzB6O鱯{!GowqqGwj=f^׬-+y}b]Z~y'6. mw~l@Cg׿DlDcG^14Zߵqk8JQ踶]jwZ$owVu&VX*bFYt֙n$6h͢،Qس(5c_3~Vy]/+wF^ǻf^G{`( $3;?;\Ol T9Tyr tRq *p9ʍ*'VvVek=Z>pI}/ihYߴ 킗fa&P_#6jK]EËU̒3YK9I~i򑈖ꆑ䜮KޡI-`Zp㯵p/@NQvv"HȻ)BF8e 4W T4 @dka7$Q8oBʝNZ:9eK;e9XҼPӼlMi0MKoFG!jlyn9o1! ;1'd&)s}< q!69:c:@OI7?k/K7%AԻvv1kFʇb`bxrpsҙgSyj1}y@Wҭok'lQv/6؍T-Egj1o.X s( A(8ʋ= #Ggq,)4J`w5v5x~m6`d1zB8 z8N9;MqOi:|9xg~yJHut~TxKa>cRJf`\BW5 {v쵰o%{%0.^<oAP8zXnzҳ0c^`m|9yqtU x^|RLQK螇[pc%{=z?Ӫ箅%!Lk;~N?~;< id8}ջ& ̣0|7B @/dL&6d,6Y!8I DDTP(TT˩VOjTkuhW[պ)GSlx/_f{}Cw6L_Bo:Iw5]kt;B%E:癰Y~>)?SJg?> wNJȪ'թ۽q@/ q8f7`r{3g1-  F5ch 0ǘ8I7໕S{+f.cXK&:Nm}WGmgx)r~daN jSn$5|k;#FFl%{c63OVst}űv戵q3W o XNp4%Y85O㽕Hv"f3u)rb-|-cܜI(;BpG!J>=(W60LxvU{=iөί`"VÙUZmT8U7@ǵ|W1bg:5઻rh?Uh7ϗr׎mRՌHWjnN6!>;s+8UOܨؼY?oƒjyaEhY1&52wg6z.Rmfʂ4=?]S 4Ԛ N邅MZ]㋺[<G4S4B-Meh(n#_rL}iOЗzpsۉkf=LdyZdO/T,L+2*5QhFevj4W#`V\ަޜ+ԓ_ݹ*uWGuf2k)}v;) ZtתOY[j*V7jUz6o[ES*rWkU>j/Z޿Xl.epԐ(NBQJbA۪\X Y^*_uˍ[hUtX>6b+]es[wU;d|Gfaꓶ['{dE ]'[-Ɵ*"yep5҆6c4XE+uqioko26m4oxe՟0OZ7 g ~ 4QI*RW$Ӛ*wk\v9*x@@X6dŌF^6#mv۾#l}Y-' [aMZ+Q7̶Vz.JZZz9r+C|ٻUUPrCM PfhL hI *.t=gMt[3]6 n5w?%Ҿ$)'CaÕZ+5ܮpJւ—i^xkn߃J{Zs{_Wb?4S] {g nue+]*F6P) -+9R"J(!Ҝy.*4?yA8 4AA@Q~98"P+xIs\d6Ҕ5a붩զn;n5ήl^w00||}U2_% 20ElEB ZFwj{%|uU++dwb+S+lҨ2 ss9ɐ;"'uemX1rf&Eg=xW3Y,CM7T F&*ПUspp-bY8p05$eTd5BW`D$-Y<|@ȡa8ukż !V&Y@+B t;w,,0-F#&&r̒2`okq]|ԤAk-䢥 lWu.h'^$RPS# 21K:3,R41 ,yrZXc~lNMIr;h_sDz6u'jȆ{&.'s4Zw,Amp@;XӸpGlcA]Ǐ]c7Erwax7d>v98fQ5uvT^ɀ; &΁Vf^ZiPlk& h3VVB< A|7hCM.D~@=OUEmiԀkw];|..>G.=/.qb~_ѫ'M OӐڊÓe9uqg=rE0@>{ܜ|r9o@=nr9ȢzK_&ٗ }!;9QqInrw-~BXK -@!Vs 0FH7XX?ffAxAMз)#'D G@%ktėhhr/h;(?(>CGFdP>a?A}D@[}H򮓬h :װ.^?V_i@U4|fO>68~\Ǐqu.{z[PI:s7@_?θ ;[8bd<.;ˋ~Ǐs(& PM|\F!ScX{R}?~n]Ww $:Tgr.ĶVtb۵nrlBk~36> $љ/\-hp G,Ӱ?kv!mv`۵kqJ7^jMeNpW7tW^wq\!pE8xi1RVy〣J | RNuRδD;qf5ȵ5r6l9[9N8 ! 424aܣT dSg֨k ))r=?W^u]۸nscYXkIjT {ʽcU Ol>3U2dphV(o" [l5UY~2.hupO|:ljZ|!0dQSU4S7"U9#f+{d,R(2G-TF22)ԩ}J3U鼦>Trxnb FVV4A%;y^ /%4\;:L٣;&Fs+sLfYcJ VJPSRM3Ue%Ӕk)Ac$p"YyA5p_ KCf_eM45tD0ORjHRBR5}\Bs5-ԦJ%5hUq͚lyA,GXY#&*kĄ>4 }lgꄿ|9"0"K6dl-#f T%LI(M Vbx'+>"݈?Ϙ<ؘYa<YoD2ڍQ{ Q/OG1Qֈ=b3\I.×LJjROS&%X͊FhuuE}^Q5"D""XY@E++ "ZQ FMR[hjNLFMMQ&ĤL8Q;m6f[XN9>w{ҕe)b#Ti$֘وKm&4bNIhӧxonLԀJPvm>oV̔L RZJ(%d2h4SsEF\#6mdDwQ雌]FDczI]ԴOnc$Ӄ4q# A9(uxm?%[&d QBFfd)6#Y1Eeڌ̹FDf1Zc[5ڮ0kB;5պ_!jJg|) |clC4'B UJž˚n*fdEeOSdvgnKW-K6Jbs)ض\sVќ.$shЄ75~G Jw2`dKf[bz9_?US#5`Yڭ iX 5^q)x\^5:朓_uλܿj .72`!|oIsع#Bq r+Xs$ic6v#Ǒfpn"D<6k??6[ ߂\l 3H"iZ1ڣи; #(pp'Cu"4 MQ(yWh=߅k)qVhGs@HCA#_8*\&.Abȸ8. ¨ ]jd5"S`B(-dc-A8=pՒ 0x39pʥNd`5F2jkѹu\ln^A@דzpFLrn\[Z-bl)Z[ˋ@9:@>Y4bN@Eo /ci`hro$+E=GЮfSlE/Wї-_h9|5_@mRjJ oWOYYڰ QZGD/؀.k EQq8v=c'=IOm mc믵:W-&pm!&zoo.XY@.BNJ?ðh=powXJ\avG_`Oq17=C |3{E6Z+t-hZ!cӿ!xC+Th_RK$:?EDg x7VGg~@K|z{-JtYz ur]& <~?Yx?^y_~<;:ŧ'>7 :&W<vQ0u9/A8 y5`ctt >K`jQ}cXѢwP2Wr\\خ25آP;Waq;K=C|.d0#LV`a.lboCVLM6N7OvIYc7tͷ.1]#؏ƾ k9Q.ဣ va@:u^7A6} p=Q;4G1N#O⺘ ,* G:_J/¶[j"-tZn!9Ď'\8M2PR(7*WYu-QƴڦuGVRi+lL&M>^KP99wHp-1,Rt'XX,nh}C(̂2?N 'C| mR=y(- Sqa Sdo3+fL9E.nQV e/P}Bo`ViJw\tS)E_(HZb784; AAi̥Iq+ˑ#ê̲Re9^斡ܫ~SrMGNإ}/? s\S3%> [8G}`r4Z>W{dwU9+#dJPFu YJu+Ydg.%:ە֌)fk)ҹG# >𪫊"+Կ3 !xz͠T6[>8WXMoHV+S.b]6ŸUEnzL!. 5 Q)~J 3 肫 4PZmx/l;D QLSǠpOB 4Sxn|^3b} @ks jgT6YnjҰImHvrx9} >(G>~zx^LSx1B0({\yuTUj?;XJX7ZOg?P/~̤q~qz1(ݘ1|ypS=FpRo b›e2^ Yz1^ xØ!fb:R”ͺD l=-k{͠PsKj x%\,)Tc.O/rG(F{\a(2 x&1j>uځT]B,OxYZ1"8MMcuXBKc5y =N _z,T.L3썱Gs@+)0aN  XI\09ֳu4rɯ{g* Jrm͢U "93&, rXJB 8%>7"6Gs 3۸w0c{u'IQ;)[J[X4xk*fb 1˾¹![w;)`VMO^fe]wxh^b/|_ft߾~ֺnpt~6Xc ߳A0/(4'AÈWqc,Qzq^Ϊ.۴^Jd|Ck|g\XNCA@H,0St9˺ca>0`瘋uBryR7{|<Ǿs*~ os2{ul\cߠ[Y787%:>揲3ư˳߇[ 6P:'{2>5.o%{d..ip[2`Vl;v+?YP(;* [eM : al73[r]]v끏~'+˶('t?6Q*qE)ש M2sj}٪sT9}[Uf{i=ZfVu ?^cq*q{H&Vcx\JͷGz*|ST^ ?xivx5ӖZ9Jl;؀쇱ߡScqOs%K:+A9@U KTے>ۯV 5^cb88ʱ_up4~UX2~,E%Iڋ{jlα#fYYv>_[9s)Y#28Z-aicWtπ5Iγ"K#|;g U?ۍ?[kp2#G1F?ȸD]PU 5i')>&q4("qg PDr'Otqi'9J& fF k\Up.\A"puA<#cVbdbu;*tv}¹1_f<fl2k҈ѬaCveϪSA}B1v(fUW.u&Ԟ3Hβr+{^ܛj}@ٿWw _%}\>x8?繁\7ϪXC]y.u{՞P$?…q /ZVKq/[KSVqͧ*u$KA'UIsXŞ27\S %See7V{26+724UƧ: ElO#GqA=|qΈ\+$P,sCAr ڣఌe*VNV p}5B6?LIOb-h^s=pE2E*dؔ%(F1Ƌk(ste`"" ma4oymyxppuў!OT0)0a$FQHVzx1c Mcq*ǘ:IBX=q[cB O|v!vSKIG?4q7N@q^@ 34H)E TGN3A|@򽙫j솿ExA!anM`-Vw8@ĎQcQD(bi26OBCH I$*Paւt1kuv[w٫Skwukmf۵ǹiNn~vk[ݭwfؙ&o>|`|Pv:yyK!2 "L,KQMTy+sh?>dnL˿9fE=]T;ټ7ٸl9t)t opBp? }#-Pf-q]uY ;Lo.*~8g4~9xB9I~.e6A;ӣX<YO8>WO2gѺgibq e}TDȇ?WK4410" udzXm?oShۜi #\[rBʱv`۽1:V`{ (-VM:?Y7ҿI)LB5 ^J'T%uc7@)4w`YhQ^{viP;Vǣ4hG7f) '{*ph6-=2Nlz@-hv6 {OZaaoIr(l}Y."]:A\q}2A̞ɖl+ڞiصaץm `;Ǝ'M%c{&e#}whXC5EM_ w),_y y1/Ou¿ixW22r,}`!~D9j21PhWRQ)@QjZTm< eD UQUf}BN!9_(f}?<[5$n(4?C\YT!6l!U4mPb1.cZv8gesqPk2";'tum8&[DYdC"t|׀?!O59 r,SyGβZ9#*-M%!Y+VRqM2gTޥʯxYFyJƲkz.FNz Znx@(w娴^鐭R֪YeTY(7B'or|)˩;WqJW*f4Q~flZ}?OV2UTPS~MPy5Q ` Cy-Cb,FNPi3kZ;\ZM 2'@ h>jx{;ϊkd d dA! p0Cףˆ0&s1֝'|Ob{ Idbw1M\A-f<YqE<iIIbp0ލH Ar^4MDG2KG"Ѐެ#v'FF {/psļ VaZh.1|񶳩DqUc|h 8!ۘby8DiWV8r]Jq ,1Ui'h4.|3&zXFz؏!}7/ 9A>I8ư?ںhMm .=;,/CCH4b1H,$q%y)~$"ɤ7`b蟣 CuM1c} «})KxIR$XF>LSXQb1FyqX96f2F= CCxc-g}m7\]MW?I;qۉ\'!HJ +)6\` ZXml-viٴ1RvN h?mզMHo* ="<'1ϡ % ^gťMЦ.vXs&sG.rE]8 ="!Cl-ve]:ܞJ9ī VŻ3N@`Ʌc~Ǐ ÙlE{ctz겛F${)|0gr쥭GZhV%Ԃ ҥ~cs-Vzupbt l~EY5DMl.ρ ͩm."1;WS?ǹ(>cAj?vse5]YMzUkB@-q8D.XXSq|[3vZK!6&99̋"`VM[O`qk:wQqn7׸sX2xYJ0 '3q{gs?or?'M]w ~bd ,Rq 'GPBEI6JN^!ofenz%|^RY'jĻ׈bJ 4PRb . +Up-ЯizdyZ>'w?_hl`W]=û4ʯhu3OIUQWH؛$ r5aq_' oum;.{/wug|3_cc4c?~Q=GiM4h :~Z|C|D~W84$ςgɸEo'Sholϳѿ{ ˳(0MAϼD@>'959̯s_)"yFBvt)3|sT-p8ҳɲ}.v_*=sیQp+A٬F&8i1211N4%&GSSv:s3JQSbnEL&Q%I8 j9?Ïqnڅ7*+dq;4"@5OuF8TOmpL>8sM5NmAA.c'uK+\d۹PFQZ\P̯6{Rρg8`ώ=7' Jlϖ/PИ~s.LtE?Wj$C.W33apQ*5{Ŋ=Avll:&8}+6a.ɞ<555V5A](ra8bpᨀʬ^v[dj>*(Ut\yG#ш-\URRZ[`ƾ V)7'Fᩀ{ ̇c1]WIQͦjb0jo|'kp]XoYZgI'w6pv ڸ[9<: . LxWx)_3MZyM#T^!ӧiP(?VAVu++KU󹖕J))Z$aJ.qS\yRLa)k#xZH 80&MxSTԷer3y2B}w@:W콠y+{9W?v2$jIDK撰敐|LZZkmSܶ>qHN~ɶ8iqZnHl#;[ ؂tꔄsEBN4 şo[2,wffV>GrZheXgD˚4;eܔĿv#Q#@5(%X^__3r ; '|7+`GE2imb*"$3JEК14EB1c7B喊C ܒGoB%Y\YfIEL1-Mgˢ ء˘n mG"FJP7뎬DG^M)s!< g|g%Ts C4@-gpTXUUUR5QƫFT#`j}B%z%Jw>}$ye)v{w%(UFuJEBX Aj-*Ԋt\GEm; aDe2Bޗ3{>bdEQφOC|njIVú8@p ȇT0Ei qƸxnit,18('mͰ> ~|>q5f5ll^ 3x ^A=Cl8l5cNi46@PO-Xp.I#~:} 9We&KLyroǎ8ug|KWrcb]OHrOĒPYkFW?]^2XqQZ!% [~,{Ơ/ѝ_Z6çSB팛 ߵd{.ψ Jwaݩ}EMDœOaW3- ҶxSD't#RRPĭ7O n+*F)j-$j1[omD8oQUqCC[^G9| VFU{V?pxWC*`e#ےсb~p̜_AMyAvmtjx*" (UTKʡr ձ]u+'$@D!$ $! %vvf 3<೸{ߔi3hg7YG!€! l/vyfchPIcs2W3ܽx l?`$*CtQ7B3 kK[Z3l } 3L==ztR%\p?';K;޴ 0m3zF@cJ/\5`w;AFjoz7[ < =x0Hb㮙DazNB?gu .a0@ K8e^}-Vq\+N |9 wʅG; kX4OhӼ]&n{](sY8qEͣfq(OiI")k KҢ&bxp:˪IїMH\75<:6?tsAB| Kؗǵjz2z]ڕѻG8Kܨiuߔ,qӷD*i-F :o{nq{opJP{&F[R|֣'ؚ̙t/{#pr][8J!9BR)#EQL[(%9܈ONʿѣO7sTÁkqȡ60_B-lRg(ҁ+M !n]ukO>uᙶ# VKMz{c7o T fE^ǥt.v;CɈ0P8(pݿvR?z_`}~3g^Uϴ75^w?[3p6?>?>$(>?pϰZ z}@Y )T\1ט.j}l*Ri5%IM~pז W6_ԍI̾4`ik*V4M4$%3pm)]f[ ,fسvehzu鲼)`D,JJb$){& N:4 csg<P`1Rrw631=6^,̣_Θ纪y7G(kqYi\FJ|7Ӟ> O yZCɟ-;+u{#g#xzvU})i%*Y+ɜ*$;uQAEFsQi&%/GεA1B(NYީJV.-7N:~2ؽCە/&?x-f{(-]r8%ȖAYP,R.;%.;NO.5ggqNin;ΎKTP! "r)G@@Hr\ÙH$hp)?ݙ#}}{>{}&=+];_a]@L> K?A*/LA$}.%lݬ!T>Sȋ^y9/^9/Ręd9j˜-v#xm dFXQPP(j3=n~r|e|>q {kS(u!W@P:Ն;4wE|p/>t :!fIM^vωq/ YOU7&~`  P(rp,oaq^K_m:ld4)c:@Oʊ %e}TB0AU&SLZtݘ[7rWꓹrZxMb2W;7s%1 L``Da6z-zER}MhGG$CfI;EXd#ψ [%hdn?߮S_oF%Ěb’Bb$t`;ES$]ξAiםa쎩QzkZ2CgTI%%J ƂTOc$&v/:E;g&!l1j.}C+VznCTyH,фHvN`;f܄haO6?\+ב54¢4LSxTǼijP%x-'w#2y2(X.Av QOPmn5?K</=ړL-T%2 8(iu%Nq]S9X+7RЛ/M wۺJ!>CS ĥ1Yon#R!/քVTQLU( R(\iN/{i#_ђ=:[[;یc]:j?8iqc/uj}ik_;NgjtD*CB$}_ a B$EY\n={7^C*3taݷu=XBw.;},SV ֻ=~iOnl>A[Œ/U{7cX(?'N3HRe7AF<v' 'v\G'kQס};)8:J\*xayr4͟mN=GKpx3c?;ȉs"Hn5iM Cܯֿ]cy N"?p['zYt"iBW] a.oU/)ut^&#W`ahn2>DL O9|x|MG=끇_98~ GgĬD]鲐ؠK>KK.+BaJ1s>~:WrPHX"9۴'3E7  mQ,vCH\$s$NvfgiDkJFLqdDzU)u5{kfV{ 8 ǔmWE7X).~zk% D']ԶYA}+'pXu@t-0E "a̴BK['qNy4Āk_I"KIcjHh$ Js-J(w+MM\joaZM\K k3hq'@ߋw_hAF\Mߑ=GʯSܐ9)yfEcOu휢y&kQZSC, [ZDn/mQ] ʤ;NUz'k=T>n$-.V}<Z{?1A Ґ-Eh0fWDSe4uEy4"R̙ Y2iHv)MuT[SͭA4"?ײmEpҋ{kQ Ivs"0?G5^۞(lJk!76Rfv͝D >}_ j^P`fAY8f"YjQg+ %ΆGUvKdyqm,QJ,S)߽^1~ :J'5ꇜMsy,7(mA컦Di(U1c%1k@wwnD_~ $'ٙ#[ޞk=|8t9JX>_tILR!q$AB@ A 5B A4kseN8vmgg;юn[3WS/- c;Aubcf=賓)[YC7s)U=ė]//{F5.o}xYEyٝi[;f lWv?{/l.vz1ճr3tܹ7JgåUϷ5ri9M/`_|~,xyI|{gW;B$Q%Xj޷K7[)ya)ElDlbk\ÄRɋ>[W=FQ%^%"KQb0{{#?mY:'5X p5N&x*mՄ縘r]L.8iE k0g`MjY;5%ÇșL8gu&[K'ˆNE=CX8p>}Ӽiމueu8iQ̣_aZ[)aKy:쳎oυAG r#7=(1IӪmPa"3ʕqqiQ:6a1Rؾ- _a[73G=/q/{8s\eIXt\PDY(& pd[.>'u1<0gFR__R3+3eEr E)efr,n$#/D2"Cp6(gyA|+ 7!p A o8A}; X;Hs$@4I)q9!ZD+Jt: ]k+MEJRi ՚()jcxhbѢdS< d_C.2 C2nE,bZWb8p&)2Ld|Gm$ꌁEu QZSg ֪i ꑰf`N٬ "C2!CAF:!\x%/f'Q3 43Z2$Q=_5LWO('ZA;٤j>nvZl\d!CA C.a<%.3X8HMGG u/&yMEM!M4U(S8US0>͂6 y9𐁋 | H_/b- H \r ;r.7Fk&iiMCHQ&i S놢4XNݏkѡ5 r7 [A |dAkPD"CWt'9C01X嶍ӊ&Huk_>Aږjkfڴ( K6 QْTOѫQ ,Y) "C;8A5 &M^p gBE&A4?R0^֥KuiRe](9J*{T*( ! A;xG3lƛ\C\%/*nvʃDq*M+g{lI-Hvɺ, xP Pwn5;mUu+'o:R|wLN/Ҵ:iiUUUE^![SȖv,ࣟ7P P (k>+j"uQ{3b'a9m4T^ʬǶWrS ߩdV 2EOU_OMx`]jvjzr}p+'D@%!6rrJ9Í 0@@A仿죍@2iVRE!盝6 EW@TYB]o x4S g^}->-am9y1D^4X۩%Ci)w?4I(1օ*;8 NfWR{Μ P;:uY5OD bWP4Q<xfZ2]!ڐ$^TcgFB|C(iWNkj~ %67P`]`dEGT:S:Y:Ƚ[&Gr@6H.~7ٚ[m溝dDWxϾ7WĴIH4tvgsx˿-ϯSXVU^R_GeW 6NBPezp7lxkߜo"!aZ"̞Jݛ{^xI-ogV= |X|o!EB m цݣ[VY[|jyQ6l}nTfa;/;\oP8q%/#&HaJC@?'libK౿UĿA]Yv"6OjB䭦_KN\7mWXWq] RGz( %-d;T!a=a  yр Ҿ^͟^ g'¯w ޴:\CqkFJ(U+v˱Yš\9U2edTBV5mX~~-ޅ#v$0b) , At6z>֟ V[&,- eeg2£,-wޣM"H h @۰CiM#$8f 'm u xs! r,(`fv(G7} H*ut!#R;do#IcW4h|_} _O  3&eua @m2邙X_6/EP ; F}hDj AzB \|I O_sMPff*BTQp/SI\#5g(Irjg;Zo֣']OVφ4@b556 $ LjNzOF)vfڐ$e)T]ԜJ\r1OʘMyġ =6pAc KgL Out%JLy9+< HBV(sV(-9r<ƫ+{ʧ7T%Gn C{!mC8fC1LVGoWst29WL)* z½5GG Yo`ٛ;כ; q{v !mԻ\S+q!n^`&VQejBr@&@ȩkEzhё?̟w^ v@<6pц+`jgH!❴)rZ\5Mo4;xDQQw.juUkP<@AGr  B prB"$!X֣2Ңɇ̵\r-R%F%q3jb?0wg?dp;l 6`C׀zT_4@@CE,B{qr[,hZ&1_uS·CakC|zw"l |A7 Ԡ@5& P#eٸKub\eBLp!S gu3ƲM]A)gP1 5h ?$@q>jΟ  dP@)}GLbZ2 9 ¹ƞ8~\Z47rD\COArZ6Æ @ U߁g@7@+&0oiҌ<<4F$#HSHƳs^b뤚| *dp=:@%l {@Wq`l4/Ǿ|SܘHJ.e=—dR{ogBVʕZHVA"-/ʭP (69;VwWШ5~d+^lBG"aN{eydWZZ%/RjaZŇk>e`P A3DzaP(<|E; AR$7kMU|])ATI EVPJ-k#4-Z ;[@ TxzB$a%i9YL3YBCaǎ <D+(%sJ "C+Qnhk"BF֗4 4Ppۺ42jQ }~5.'t_Xnby&:YjdtRLnA:zRK'nG6Tr. p]/B|f)Cd}}XMeLA\˿r%uE$ y@i1P#rT.3rC Y ` 6aC=`ݞG 8D-?7] nE nIZG+?[Lmו\ ci"tw\'X T*mzhpp]ڐx^S{?1kB;O >{/fVpjTC稒XtQiW&ƮJX2F Ff̥ro`>uzE#aV'N~ 2E'C?^.#íJM/OSHj}?GM)tmjϮtt-6 _SzX{~bGFs{'ml7y)ʿyP,w*(q0Ӏʍo8r,KK#~Eq}:i7I[ lC[A]nMqfK)'w3ܝ˗!_`<Kş?_5ޅ}&(G>nE=b'LۦAaz@tLG4L4& ~=慦.dj!Mh܂][p͒q7_u\[8w2ᖜvX;9|ދ2W8AF3г \~5zLG *zAAA/*7m's"+_Tn_7p>Nf2p24efĿ;}s(dك^.~P%仔W\.%"W䫎M[b!OX b6n6ƿ?}-p5pr!'O<8Nc;z* ,ř'#A tDD>iĒO n?V`k<Ο aL81p 6NܸTN.o9m{#ߚc;-񉞖DaYm .&Q93|nK3x]"m H C` 6a[ý@ (x3tC0+"^ԇq . {Q;NaYV[x||X)˶~7V{:/w8a+\vm-:ÏAMS._%H?#3a#1+ 8,E!/VxX lކU[tv'n8JY e v[ ?`\>grDnA,yа.By 3?_jC h&;@E^v[> {H2i1kTb CƬ>ðg3HC? ,",A`! .U@fT%O]R"Wi6)ކ (^_Dݗ?FѬH|_ mlj"2^@`e ,Q4z9Cc]Q[&!hZ$ BҐD,e<ܑ+(p"+@DBg5ӴӴJfs߇n95ehͶD$/ZioqD}J@b>pK-EЬ!ES©悩 ӯݗKԭ1PÜ; iȘ?l' A0J;Ajf 5S e$h2x2xR<vhquTˤc-7\8@{{/z"ҐF,hz)ۡ" bzdIq(#d"\7V[:֪`׽)y+۴a`Pp78,dA.8azkCdԋ:ǂd=ؔ4&u'4v%71^L1Oem=F(1%ւ#(Hd: n_ҧ-8ؚ'3+[mEJegA'UWN)o-Sv*ԤAE䤡K蝾B۲ck~;As|pt9vu GŠq!OZ.د>ԩ՜(\(T_<]t0r6 mVWH d?s%-mv?Cw|tu\h`_{TܕQ^v|y</զ{Ku9ݜ"I*[f`ac3cd86;E"K bZJ)>z߹Ox|?;7JoJݼ)ycSM)RϪZi6LQ`fRcTgoⴟEw~ ͒:d#ԊʨEl-vC\ͺ2Ml~KsvĜSenH<ޘZ ҩT!je6 l~?B;O;|L:^l=+ jh^S}"lKɱCq œ'=tClޙqΪk !jH1{&fp}/ܧvd̼u*ϣ09i!M=۳"%DL RևU5W;QZ*l[.*_;d"P3a^f6u+uq_b,>sד]W\qI*nLm ٢6*euƑ5AM kj:kmGE!KO;%ck z.ٌ|dOXN@^pC~Ypa.E[؁1miҎ2EZ._*"b6Ȧ?F衆E^/zhszl+ǢK3oݏ}B%uD^](vnJ~aQ@Wހ{WoJطzIZ6تP4Etޝ2!]w ޙ 54AwOע\WMަ59+{;y۶ .ߙ/ro.mC;A Xr>Ott,,v0;4=;:{7UV ~nO&}M:4T]A>!3VZi#W"mD/ i#Nf#.y#+RGV' B"C/Oޛy[>ʶp?myFΗɜ-I_=Wmw WOȕQiHǕڸ6湰O=;*8H([}E37oǷ!zxpjs`sP,s> %!eإKj0Y `i+,G3K+a'ch2r7x)YW2d \IGb6]"JL Z! iMHcBJ0Aod&΍<+%Vc#>}1~L2&xV8fb̵a,L,fѱ9pL=<.K \LlVHhLHޥ?"$D/П㦬_gadʁLh0]3[, l/rGkpi8N d9թ6B$!yO 2@t%_@ AlLp#&ϱOsa/֘3 Y|!-X%fgPa, s[3ZA>v BLd'^V:/`1X`0@O -W2h AL钃OG=_|^> (g6p/ o! TkՐ"mjf_ 0`=|ث'3e{>ـ?/`k5TjAH[!Upku*PFQCQG WU`>TQĈד^@@⥨_ѳr@#c0#CHfObl-!n=;"_j$B{C$QpE9 h0Q`\ۃGk@9 ! >D8GNDp:k$gH|}q028Ydoyaky>t<1G 2zNzN~f FG@s#$_7@8sp . 1ؿ/0ho3xIYo|Y.虿61_u0~ g,NgOh9`'fu?vݎ6 ,!ar26ž/XӸ ţ  q_K?Vs_],̇#Ƣcp;яyޝOklng຺@AHp[z@Ԉ_0)/P|;i(c6T8L1QʛFbfx}q2:0m әәә?R,-!i-Įwڽ Ady|N}Uz"3 @D'bԇ1t9ʄQC7}ž)a{¤%q"1i"n">y"'@gl368B vp}->  MQpQ9m +Agvņ8sM!nÎq1I~,RX.uLR:n,, 0Wց3HvyM}Eǜ$o:+5ML8D~mlVb9Vڈ#<"O ÅUFaiqDZN)0 x{[ L ڵ mmk(]+C=" xm*%F*Wz]\kSR5^4( ť!Y e 8ΟANG(:mˊ;7;2Y1T $ q\2YXMV jr|Et(K}J9_)+hR`:(7HK- 3HYxWd*(96-jOo}9?Vޫ n%zajfUPThB^]hU1+$r1,ѧʥ+rB k Pbʯ_W[ssuNy~AxGia)z _."*1_*UvSݩ峻*nS.` }*Sll (Cf(rX~pKQSkgmk[w]]& ]Đ*e'$ :t C5)SKuiijSjl Yr7Yr?tl^\l8wf >(>:X'pKRKR6>+ԣ jjb:!P$& *.)@36Aom/kX>o<`1ݾoký[r|ՍHU$.6ŋh "VD+ҪR-LW,.Vu]Ln:>4/1e pu[rumfconuٲ;7ðHJ__SᔅUᗪamRdESFTхh˭ JWѯE7;!ƻ!כc@#(7g=lk}o t4W*ŏWg[}w+MFKBnCnrzp>3#%F #u#jg6 ʝEbgv`DW>VP)Oo(KGIbTKoPP_ Nӄ2!?@vѪQq&йJňGU"6&4آހ=*:>U"7ѸRuR73k&` } beTuqC}F,:QHgG ; fv(Y!Ģa3 .}ws N%PIȶ>C0{^bx.KI d/8tBXx$ֆ#&b  dE@S Fܥor4tP݄T 7=A)Yߍ aZ`*A -CJR! XK.w x!~`iH`LWB2leb0J[ Ȱ 1VJ /`")wL26=15,r .BzhƄ@WDS&XوQ@J~JrҨ&%. p2pR yS2\jDO^BXJTO5` 5`Sթ{@䗪W ҙ9O(z&U]ꠠ:h[=bfiLӐ#&Nẽz>|HC#HN_i"f0{L+<FyP.[ !Auǭ(Bi% MH{4! &4i)0";$N3٨|خ3r i-̤_Lg}o}-1ft(G1ӡr涩G,-kv4m`7 Ɔ!/)$eP*0AXeѐ`Rp,Bx2,\m$m8iCv4lu? ΢\@\|ABuQ+%1PFFq:V>&ѬENWOJJN;_ /P.Svvk u/Z C%LCM9Ce/˯TB(5oa'ռ qdJ2k6 im%*)wYޥ>UT{S\ڡ(m38 V|ovT^ k_ry0z/f7rjc{ L֊vEبX ߴ+kumojlګnX7]|WM~_}5g\&0.Bbl]:Y!SQ#;3m2MzYg-=yK=S}O9\xgjoZ6Y[j^?upc0CѩӢm"$%o5n,1ff`̂8"%D!u8Y,u[=N-|DƼLo}@xQGxqu 0JK n[!iLߧaΕ<_]><3u0NP\fod16^ױnEu:Y7cẌ́ꄅ̪ʄEj`44Dmփ);ta>]kb]hvxQe10c&iX6-V[m&TsZr5y^U<4Sqg!P6´:W )^v܁y#0?;:NLj0kĜZb1 :_E_&=䫒 Di\9B4[]i=خ shC_ˊ?/;UsL== LJg$gPiٕdv*Y T˄ rrS()iAaL8e6_DCWcHdY۴`nɡuf^U4>iG(2OH jv)!Rsb1XR\:P(/Qa^ꔈ:-Sg  H~zH6Ԇ(إM~ґuҝ4V} = [4b8&*V%4Q~:[KʳJ9^/gߑgeY )M{TȡM4P gM(ީ8\e~^g5Uoe0|i__egEs"4F*J8<ɐ3 :SLc(RY] *AYc1!gLJ2e?*\ Gam-PIgͯsM4osWG Q1W@гidmcFQ3F7\L6^j] TG9cӔ 9%)$TZP"SC- IhB?!NJ54!Yy((+ցh0ގ^S6[:lu0Y]2ѨobM0`Pui} TçJR{aq=Ю4[Towçzw ͻO ,lB&Bj y(E0@-d~? 4MAbDW࡝ gܩQ7/\h$x} sG.IOtm $eWջ`*PKt9#uk {5+PUh^hgO#\|f=}fxhh'lۼ$Ym;a /Cf>F:}vHp}u S)~o?Pݚ·zv2?vFv_{ ^#;D@=;h@䓞Zg#4gFa#ʑs3gS>+֎+g8{ _ot ~TxZhߤ\|u9mU3rkmuCI ł[0p> &>qhnm@8ANfC(w0*{x0= !>YHw35 TcixV'C=-ܼ! nwx 0gsVtwXWl!HHVH; P#K{:lźXJkUzjjE(T(twȃ\@G4cq?p]N܃?R^rST( 57Z R'QLak[:hp^ Og\\pu"WtW+X-&IҨk6iB&`"C$.ttr%eû2^\xq# s8..npAυ(GC0A8!`O t$\Me e`ـEs(D&Ⱥe<m |#Azoxa 5r!|&/G@ڙ9[kX`*ɺk#,}!D"l$?D$bZ!tR0M8D>"Mmm3hRHmpCy"b])^2j̰I>rJC'.'y?GM?z)z'̊^gſg܍F&#<+SDYBVH;#>3ɂAx:4vZ:ko-Vcᨡ҇1eҙe4T_F4FRc(LDPY1%K(%c"[auˆ1=q8jGx s\ދ=O7?-)qZq-i:JfӅt1^io<7S]'"ҤܑKin@L?N,U4vIܗqGdeWߕ7a@~'a΋fd#Ylj⛔w6$vꗤN.խ۪nXN}qfHՁȵC>w2Tk:*f:P.xZ Gӫ,HIȼIњۭؒw=eO#yWR]Nλ(MiջΌcGF H$I42FW~Xx!b>̡oMꄐ;ʚ.ecEe{yՎ%g2N^}2WݙR},{`HܑҽĞ&HAܒE0ABZ-@u4u"޵2͚TᵕY]E9gs+JNfYy"x抯sT9Vq$Bš[_彨؛?\];5A6̩ [anڃ7xer-ұ%.Z6#Ly~VgIhaum5 v|YpvO݅ݵEn/Z4XhzSPƢ5\[Ɇz(0Xj-4XΛjfVV߶1 lh]nI?Wu8\Y\jzꎒ[궕RrnSɕ u65z`Uk@&P )(֟UK|_s8p׺dp{;ړ'[ҥGW*Z^]q}ٮֲ-eW66kh*{V?4꽍=C,32YN0Dj0h>&k&)JVEQ='-R.%EzNyf^|//߬Ҭ)$MvUL%HhCX2bB}bt]8̮p51[rRHTmr}wDτ۹˶s_MMJ1rr \yXLVuܯ#m6[\ؿuJԵ;zmkm|xGrJmY:WXUXϫTꪳy-znVe=qs˳sd(h e)_~< u­ΥW]9g~@Q"vLLQ<[̭kuiڤ5IO+76 I49L|yHy]hִGtл[Z#qBklL(OȯI/e j˄u kbW8'JH(% U$Dž`础FX%OPaUvI uc!wQ1OC{;v8!VДmLg-kyYYyTո0Z4.䔏ǖJdi%%0Qx­Tҫ ?aHWn?ܳz ⎘hޡ-܄}Ȧ҈}E͗ac=E5őUa,P+4S:2 f2ulܛN׃®EƮjFkk%h.η 8|{?&, T 3 pAݤܑݏiP3+%P,~l6f7:ڵCBs"|Gx{?n |t6hff#<ͮd`d7 ;8K1hg4(ґb(rl4^M:ZM:LxLxNFLu6Uj=Vʩ+i$&w3'srſ)@ּ3FJi3⦭ §m+l]Vx}*x.+>pti^_9}}`O$. @0@@'9JW5oJoa,cY묽ʿ\bEm0m<[K\fZ` ֊_%F2K2t"G/6)MM@%(TU FͅkPWI5GKc[dJ3K`ПH3:& n(&M>qs?2+@2`sW_A*eס7.X QSZd d2ZYOtu1HG9ښD Ա&MU<@2X{ISQoH!Ⱥ#(8|;-F%UQC55RsIqt^JH94ܤ&DE$IIK9v!;,GAPb!dl*(U5PUM-D5E4R!CMmTUʀ $Ay&hZfKuA <  L` QODL4h"ژhxFE&0!Mߙ#9!d 92Քњ@7DdZ ^M 4M9fhШk %DnK-ЬO1noYBYhy_+d)$;訣&ZѵЊl}d2B?Q]L$\BSN_7lfs33cٴflH.S%n)NW!%J?~ޟxޏ lR:`VX7 0Gp8ڃk{}ܜݜlN< , j%cP<9]bv`;#Ob~uǫty?<02pF V J3pZXq _D+ ۀ[$\.9_ݎaz\g/n|!t1<14N1"d <ȦK@P` THaxd10G"r/S-Ϟ{I 䋄 qgn#aoxIT ] [!$eff:y=gL/$OҤw{J5y̧Nz{׈_kCO=_y>&?ʽ5k>&F@&ja56J`x;"> <3'PR_6P_<yF;Fyr8:Q1Ꝑi4p&@56)/[ˍ ~$l<4fMeǒ_d0$Ahm཰aûn =菈A"GЧCkDe;'5?1D\R~ԇu_vn+Fu'lhߝH&=;ȂQ W"~gtF\fE__Eœba~><;<ĞcB 6XL2ӃtE қʴ5t^6$!z" g $ 2.0)鍩bg5αvzbXgb{XX'dwpp:fvkX!Ɔ6Ѓԥ ]MvbވoL?@Iӕ4Ť GpSpS=={8{(2ww<#q7kM%} @X1Y:39tޫ*{TH\r+M<">OeMByN^%';(=359eR=#S)N64ŋ!y1:0ӞR~yg%c*ӫ{S<+#%fPd vm~]zM$8(.5 E5㢪镩4MT 5҆X8.B E:m+1FW,Eլպ^wbqĖ(lĨlaSzcZ!ΗKJ bqH|LV(Od*J6S%EUwU@(6 @yL!勐5 + {槫ydk˾Xj[!=/%ZV*E3PEZR̗T)s%JR.U$0lɈLT6S1ׇyj/@ *uȍȥf܂s'wWPKjU 4W&UdK2UQ%vgH{E;b`NƦa$u6d]G-?hh#n+ZvlwFm+jjPP.M(۔[*̋)ۙS~\,&g 2 wQA^}nfkvP *EM1*5EQPJ!PDѲ F˅5 r}n77}Ss ͹SֵXk ~aMV 澽Q9 plZЏ>T[-q,QpZˋ?sִsMٳ˴kWٱ"5x)ז$i]}mR͖ :&[ .PD5?ɇ;y'b5ʒM+Kӣ}xZVFIΜ R^\}ARɡyI%?Iŭ _M5? vYs-}zpg3}jb:-5g|U'gV'L:9|ƴIJ k˿WQ4- *Z֛5H؃o㊺-> A13)_K[kϋUJ9\)lRdjmzbBMVZlͼI15cjE]w"%l}Rd]Kbë"?L,ժO{pz@m@%"!&t{S7~u^ε̆}j}l`+S#̎_ް)* 2jy0ՖtcY࿻. 2)/ eo3rG&&YM:{F EȻqưtl{KB6 ~P!SSo#Am PD=8] PVG3@]W6X} ? CgHFg(RZ -Ұ"%\КkilWh|;>PywV)_\S^t:PmC=sX@Kȿ5tz8lr7&[<>ەe~Ջ}ze^ rwS䚾o}ԣP+>)>т V F3HEFGS_[YͰxtl`8 K 'zTW` 's .sFXE&-8G3xg/ kȿ3 czG qcq(`)C%K^cqdc<N8[NEXe7OYp 6uOO'\;@D D0xq8NȲ!߁R'tu~(4 D;k̴?pXv k `B@HX?/a#]F:q icvQ@^yU%8p&cP$e ߝB% yZgd9S3:ei!֛8Gsu %rsg{~6qpiMWY%0PD Ejgzsc&]5XI /|K=nx-61c׷DkURQRe7K 33!ӱ߇L>=Fy F BiI_Rr@Jo[AҶ?CW!~z6' DUgӴ4{d\ n"7FƍqӑÌۑQ'À1]0>phZ>P|FjO-~dnk/ _px!S,1naafAV9qUOd#{%N&rZ6a9InuD8sj=N)BS&zö#JDo~^0 }\^|fp#s˥ Κp:逞U.OHF[ek0 +TbՂ !(ؤ-,愅+AosF Yȵoa'g0c=lqtgOVDSIYUr5<ŘT*J6HZ!>$mۤQq*} H'H_$eK^%/w]h.R]w |kW)ϑK-Y-SBh}X3K5 ~R'3RrE^"ϑ;!Y~En[fK3dJ2dϰ dg kEN&@r;8Wo, Y|܆Jܔ 6'K'1Zڨ8TTtU&MUFҫ+ROdW3 E^[wnfp%/t`l{=haWq꣇b71+rE"ZneTH:AjjB۫ku2ZFS*O*3u^]׬ȹ ؑs/*s8зN Y',t*ѨO1dņ"#f7&T^dxM?`9XX dtw= +sT . Z#>=LsyYܶ’ݖCDs^+"IRf)YDSg1p]megkN4)Y2Ɛ{j:>-UGCٛ>5Q6f3kJ>EVJ%Y|qQT%8fKy)-w^gOqbGbA1UȻP~//Gzw.]Jvti`rPCMBR5jQ\Mz2&?ZS%vckGy;\R|"╀l)$9h&̾h=(F`O{zm>9L=FڤL`Fp۸$FkP(rk.ZOjmŴݦ>jz$ԼMpf/N0ԂܳrК~^ oxaaV*6`/'A>&'{SH^З+'DFGDEzF=ݐujӕn$s9+jp֧fԏԗړ]g?%4 78绂/l?^ŕt8D(!wN2э#U-~qVpEJK.%85Za9 m1美[ztok#n>7hky:zg@[hv #O>OȘ)A:a#;?&vF(]ȮHmأr{: U='۸'AOzdn qm_@kyu Wl2C!SnBcX=Iu+bXj7*t߄l%/%d B=G_m>$n  / ra4"&J-Q I"W,FH } 5CMg2$! rRJHmBGxx/_ZB%T F P B7$ }* fS yˆL+h!^k$$GB\ Elω{ ]AS9o)} _Q[DAS@T@|!$/` _ ]"P&ġ8EQ!f d™R!H b $+$$] >1GΈ"Ǣ>_ 9Q/1%:4r ~VTJ(PQ&= Ň,`ZFfB#[)t'_%} O Bxtr rr0+``W7[C70Lk|PK+/y.꠼rQ,M> e;-wCAC``J8*FPEjNQ TQ-Pd]z\4xI&UOvoݶZ声FEgX~xw'Wn 67l0  R礈 jD&`?{>Ac>[0b3S]GR݃i_